Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28486
Trapped Gene
A430107D22Rik (ENSMUSG00000052142)
Vector Insertion
Chr 17: 32528181 - 32528280
Public Clones CMHD-GT_467C8-3 (cmhd)
Private Clones OST29901 (lexicon) OST18822 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609135 (Chr17:32528281..32528344 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTAAGGGTGGTCTCCCAAG Chr17:32528309..32528328 59.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609135 (Chr17:32528281..32528344 -)
Downstram Exon
ENSMUSE00000432688 (Chr17:32527743..32528180 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTAAGGGTGGTCTCCCAAG Chr17:32528309..32528328 59.13 55 GTGGGGTGAAATGCTCAAGT Chr17:32527989..32528008 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000432794 Chr17:32540001..32540503 CCTAAGGAGTCACGGTCCAA Chr17:32540084..32540103 60.1 55
upstream ENSMUSE00000432798 Chr17:32536235..32536374 CATGCCTGTTTGGAACATTG Chr17:32536285..32536304 59.96 45
upstream ENSMUSE00000432783 Chr17:32536030..32536108 No primer for this exon
upstream ENSMUSE00000432779 Chr17:32535862..32535923 GTTCCAACCAGGTCCACAAT Chr17:32535868..32535887 59.68 50
upstream ENSMUSE00000432774 Chr17:32534966..32535036 CAGAACTGGGAGCCTACACC Chr17:32534977..32534996 59.72 60
upstream ENSMUSE00000432768 Chr17:32534439..32534565 GCTGAGAGGGACGTGAGAGT Chr17:32534485..32534504 59.58 60
upstream ENSMUSE00000432763 Chr17:32534255..32534353 AGAGACCGTTGGATTGAGGA Chr17:32534283..32534302 59.65 50
upstream ENSMUSE00000432760 Chr17:32533293..32533829 CTACCCCGAGCAACTGTACC Chr17:32533753..32533772 59.62 60
upstream ENSMUSE00000432758 Chr17:32532767..32532911 CAGACCTAGGAACCGCAGAG Chr17:32532882..32532901 60.01 60
upstream ENSMUSE00000432752 Chr17:32532020..32532164 GACTGCGAGACAGCTGTGAG Chr17:32532052..32532071 59.92 60
upstream ENSMUSE00000609138 Chr17:32530983..32531219 CTTGGCACCTAGCCTCTTTG Chr17:32531071..32531090 60.01 55
upstream ENSMUSE00000609137 Chr17:32530686..32530887 GGAAGCCTACATGGCGTTTA Chr17:32530856..32530875 60.1 50
upstream ENSMUSE00000609136 Chr17:32530468..32530586 TTGGAACCACTACCCACCAT Chr17:32530552..32530571 60.09 50
upstream ENSMUSE00000432735 Chr17:32529343..32529733 GGACCGATACCAAACTACGG Chr17:32529366..32529385 59.31 55
upstream ENSMUSE00000432730 Chr17:32528991..32529148 CTATATTCCGCGAGGCACAG Chr17:32529104..32529123 60.75 55
upstream ENSMUSE00000609135 Chr17:32528281..32528344 TCTAAGGGTGGTCTCCCAAG Chr17:32528309..32528328 59.13 55

*** Putative Vector Insertion (Chr 17: 32528181 - 32528280) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432688 Chr17:32527743..32528180 GTGGGGTGAAATGCTCAAGT Chr17:32527989..32528008 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACTGGAGGGGAGTAGGG Chr17:32528244..32528264 60.07 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACTGGAGGGGAGTAGGG Chr17:32528244..32528264 60.07 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052142