Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28487
Trapped Gene
1700011L22Rik (ENSMUSG00000031682)
Vector Insertion
Chr 8: 81734657 - 81737376
Public Clones not available
Private Clones OST29850 (lexicon) OST17279 (lexicon) OST4365 (lexicon) OST2007 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211715 (Chr8:81737377..81737450 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGCTTTGAGCTCCTCAT Chr8:81737414..81737433 61.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211715 (Chr8:81737377..81737450 -)
Downstram Exon
ENSMUSE00000211713 (Chr8:81734330..81734656 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGCTTTGAGCTCCTCAT Chr8:81737414..81737433 61.82 55 TTCCCTATGTGCACAATCCA Chr8:81734424..81734443 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000211714 Chr8:81772119..81772469 TCGAACTGATCAGACGCAAG Chr8:81772265..81772284 60.14 50
upstream ENSMUSE00000211716 Chr8:81753216..81753292 GGCAGCTCTGCCTACAACAC Chr8:81753260..81753279 61.01 60
upstream ENSMUSE00000211717 Chr8:81744143..81744204 TGATATAGCAAGCCCCTCCA Chr8:81744175..81744194 60.56 50
upstream ENSMUSE00000211712 Chr8:81738792..81738864 GGGGTTCTGAAGTCCCTTGT Chr8:81738832..81738851 60.35 55
upstream ENSMUSE00000211715 Chr8:81737377..81737450 CCAGGCTTTGAGCTCCTCAT Chr8:81737414..81737433 61.82 55

*** Putative Vector Insertion (Chr 8: 81734657 - 81737376) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211713 Chr8:81734330..81734656 TTCCCTATGTGCACAATCCA Chr8:81734424..81734443 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTGTTCCCTTTGCCATTC Chr8:81737348..81737368 59.03 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTGTTCCCTTTGCCATTC Chr8:81737348..81737368 59.03 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031682