Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28488
Trapped Gene
Apoa2 (ENSMUSG00000005681)
Vector Insertion
Chr 1: 173156273 - 173156469
Public Clones not available
Private Clones OST29841 (lexicon) OST28645 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687435 (Chr1:173156274..173156504 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687435 (Chr1:173156274..173156504 +)
Downstram Exon
ENSMUSE00000687432 (Chr1:173156274..173156468 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687441 Chr1:173155185..173155252 No primer for this exon
upstream ENSMUSE00000687437 Chr1:173155215..173155252 No primer for this exon
upstream ENSMUSE00000687434 Chr1:173155222..173155252 No primer for this exon
upstream ENSMUSE00000300452 Chr1:173155223..173155252 No primer for this exon
upstream ENSMUSE00000687433 Chr1:173155399..173155497 No primer for this exon
upstream ENSMUSE00000300444 Chr1:173155415..173155497 No primer for this exon
upstream ENSMUSE00000687439 Chr1:173155418..173155497 No primer for this exon
upstream ENSMUSE00000687436 Chr1:173155430..173155497 No primer for this exon
upstream ENSMUSE00000161562 Chr1:173155797..173155929 No primer for this exon

*** Putative Vector Insertion (Chr 1: 173156273 - 173156469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000300438 Chr1:173156274..173156506 No primer for this exon
downstream ENSMUSE00000687432 Chr1:173156274..173156468 No primer for this exon
downstream ENSMUSE00000687435 Chr1:173156274..173156504 No primer for this exon
downstream ENSMUSE00000687438 Chr1:173156274..173156510 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:173156323..173156343 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCCCCAGGGCATACTTTG Chr1:173156266..173156286 61.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005681