Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28490
Trapped Gene
Faim2 (ENSMUSG00000023011)
Vector Insertion
Chr 15: 99330729 - 99341012
Public Clones not available
Private Clones OST29790 (lexicon) OST25792 (lexicon) OST1912 (lexicon) OST1870 (lexicon)
OST1752 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132682 (Chr15:99341013..99341066 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGCGGTCTATGCTGTACT Chr15:99341035..99341054 58.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132682 (Chr15:99341013..99341066 -)
Downstram Exon
ENSMUSE00000352311 (Chr15:99327436..99330728 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGCGGTCTATGCTGTACT Chr15:99341035..99341054 58.98 55 TGCAGCGAGTTTATGTCTGG Chr15:99330459..99330478 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678944 Chr15:99358011..99358448 GGTTGCAGTGGATGTTGCTA Chr15:99358120..99358139 59.72 50
upstream ENSMUSE00000451764 Chr15:99355132..99355330 CCAGGCAAATGGAGAGAAGA Chr15:99355267..99355286 60.33 50
upstream ENSMUSE00000550805 Chr15:99351600..99351703 CATCACGAGCATTTCACCAC Chr15:99351646..99351665 60.12 50
upstream ENSMUSE00000132683 Chr15:99351140..99351204 GGCTGTGGTGGCTCTCTTTA Chr15:99351147..99351166 60.4 55
upstream ENSMUSE00000132674 Chr15:99350733..99350786 No primer for this exon
upstream ENSMUSE00000132676 Chr15:99344831..99344881 ACCTGACTCTGGCTTGCTGT Chr15:99344842..99344861 60.06 55
upstream ENSMUSE00000132673 Chr15:99344348..99344387 TCCCTTGGAACCTGATTCTG Chr15:99344360..99344379 60.04 50
upstream ENSMUSE00000132675 Chr15:99343780..99343817 GTCCATGGCCTACCTCACTG Chr15:99343793..99343812 60.53 60
upstream ENSMUSE00000132678 Chr15:99343212..99343299 ACACCACATCTGTGCTGCTG Chr15:99343272..99343291 60.97 55
upstream ENSMUSE00000295594 Chr15:99342927..99343022 CTGTCAGGGTGTGCTGTTTG Chr15:99342989..99343008 60.35 55
upstream ENSMUSE00000132682 Chr15:99341013..99341066 CACGCGGTCTATGCTGTACT Chr15:99341035..99341054 58.98 55

*** Putative Vector Insertion (Chr 15: 99330729 - 99341012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352311 Chr15:99327436..99330728 TGCAGCGAGTTTATGTCTGG Chr15:99330459..99330478 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCACGCACGTAATTCTT Chr15:99341036..99341056 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCACGCACGTAATTCTT Chr15:99341036..99341056 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023011