Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28496
Trapped Gene
Cd99l2 (ENSMUSG00000035776)
Vector Insertion
Chr X: 68703849 - 68745696
Public Clones not available
Private Clones OST29654 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000623703 (ChrX:68745697..68745779 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGTTTGCCTCGTTTTCTC ChrX:68745720..68745739 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000623703 (ChrX:68745697..68745779 -)
Downstram Exon
ENSMUSE00000382881 (ChrX:68703786..68703848 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGTTTGCCTCGTTTTCTC ChrX:68745720..68745739 59.99 50 TTCTTTCAGTGCATCCTCCA ChrX:68703780..68703799 59.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000491632 ChrX:68745697..68745820 CTCGTTTGCCTCGTTTTCTC ChrX:68745720..68745739 59.99 50
upstream ENSMUSE00000623703 ChrX:68745697..68745779 CTCGTTTGCCTCGTTTTCTC ChrX:68745720..68745739 59.99 50

*** Putative Vector Insertion (Chr X: 68703849 - 68745696) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000382881 ChrX:68703786..68703848 TTCTTTCAGTGCATCCTCCA ChrX:68703780..68703799 59.37 45
downstream ENSMUSE00000428725 ChrX:68703114..68703182 TAGTCGTGGTGCTGAAGTGG ChrX:68703131..68703150 59.9 55
downstream ENSMUSE00000306753 ChrX:68694249..68694320 No primer for this exon
downstream ENSMUSE00000306743 ChrX:68693700..68693786 TCCAAGGCATCTTCCAAGTC ChrX:68693731..68693750 60.19 50
downstream ENSMUSE00000306735 ChrX:68691309..68691374 CACCTTCCACGATGTCTTCA ChrX:68691314..68691333 59.68 50
downstream ENSMUSE00000306727 ChrX:68683486..68683524 ATCGTTGCTGCCATAACCAC ChrX:68683477..68683496 60.92 50
downstream ENSMUSE00000306720 ChrX:68682222..68682341 AATGGTGCCAGTTTCTGTCG ChrX:68682294..68682313 61.1 50
downstream ENSMUSE00000306714 ChrX:68677199..68677264 CCCCTTCACGTAGTCTGCAT ChrX:68677214..68677233 60.13 55
downstream ENSMUSE00000494682 ChrX:68673245..68675924 TGCAAGTGATGCCTTCTTTG ChrX:68674128..68674147 59.99 45
downstream ENSMUSE00000400417 ChrX:68673240..68675924 TGCAAGTGATGCCTTCTTTG ChrX:68674128..68674147 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAGCTGAGCTAAGGAGAG ChrX:68736679..68736699 59.48 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAGCTGAGCTAAGGAGAG ChrX:68736679..68736699 59.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035776