Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI285
Trapped Gene
Socs4 (ENSMUSG00000048379)
Vector Insertion
Chr 14: 47896897 - 47909191
Public Clones GC0459 (tigem) CMHD-GT_533H2-5S (cmhd) CMHD-GT_447C9-3 (cmhd)
Private Clones OST359380 (lexicon) OST133726 (lexicon) OST67864 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370481 (Chr14:47896818..47896896 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370481 (Chr14:47896818..47896896 +)
Downstram Exon
ENSMUSE00000689004 (Chr14:47909192..47911242 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGCTAAATCTGAGCGAGGTG Chr14:47909701..47909720 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000370481 Chr14:47896818..47896896 No primer for this exon

*** Putative Vector Insertion (Chr 14: 47896897 - 47909191) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506084 Chr14:47909192..47911266 GGCTAAATCTGAGCGAGGTG Chr14:47909701..47909720 59.98 55
downstream ENSMUSE00000689004 Chr14:47909192..47911242 GGCTAAATCTGAGCGAGGTG Chr14:47909701..47909720 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTCGGAGAGGTGAGAGG Chr14:47908886..47908906 61.63 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCGGAGAGGTGAGAGG Chr14:47908886..47908906 61.63 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048379