Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28500
Trapped Gene
Map2k5 (ENSMUSG00000058444)
Vector Insertion
Chr 9: 63011998 - 63042008
Public Clones not available
Private Clones OST29491 (lexicon) OST23817 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326330 (Chr9:63042009..63042054 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326330 (Chr9:63042009..63042054 -)
Downstram Exon
ENSMUSE00000502404 (Chr9:63011576..63011997 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGCCTGACCCTTTACAATGA Chr9:63011596..63011615 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488693 Chr9:63224930..63225709 TTATCGCCTGCCTTCTGTCT Chr9:63225154..63225173 59.98 50
upstream ENSMUSE00000219104 Chr9:63219544..63219592 No primer for this exon
upstream ENSMUSE00000219102 Chr9:63205800..63205867 AGATGAAGGCAATGCTGTCC Chr9:63205803..63205822 60.23 50
upstream ENSMUSE00000219118 Chr9:63191194..63191263 CGCTGCAGATATTTCCAAGA Chr9:63191195..63191214 59.02 45
upstream ENSMUSE00000697519 Chr9:63188206..63188240 CAGAGGCAGTCGTCTGAGAG Chr9:63188214..63188233 58.86 60
upstream ENSMUSE00000219106 Chr9:63186888..63186928 CTGGGGAACGGAACATACAT Chr9:63186897..63186916 59.67 50
upstream ENSMUSE00000219116 Chr9:63185892..63185959 GTGGTCTCAGATTCGCTTCC Chr9:63185901..63185920 59.81 55
upstream ENSMUSE00000219115 Chr9:63177715..63177763 TGAGAAAGATACTGGCCAACG Chr9:63177720..63177740 60.26 47.62
upstream ENSMUSE00000219119 Chr9:63170010..63170074 ACGGTATCGAGACACCCTTG Chr9:63170038..63170057 59.99 55
upstream ENSMUSE00000697522 Chr9:63166603..63166618 No primer for this exon
upstream ENSMUSE00000419490 Chr9:63150928..63150967 AGCACATCATGTCCCAAGTG Chr9:63150948..63150967 59.55 50
upstream ENSMUSE00000419487 Chr9:63141503..63141571 CATGTCTGAGCTGGAAATCCT Chr9:63141510..63141530 59.3 47.62
upstream ENSMUSE00000419484 Chr9:63141331..63141412 GGATTTTACGGGGCATTTTT Chr9:63141372..63141391 60.02 40
upstream ENSMUSE00000326547 Chr9:63134206..63134267 GGAAAATTCCAGAGCACGTC Chr9:63134227..63134246 59.68 50
upstream ENSMUSE00000219122 Chr9:63128826..63128874 No primer for this exon
upstream ENSMUSE00000475873 Chr9:63110921..63110994 GTAAACACAGGCGGACAGGT Chr9:63110952..63110971 60.03 55
upstream ENSMUSE00000219123 Chr9:63109951..63110001 No primer for this exon
upstream ENSMUSE00000219098 Chr9:63104784..63104855 GATCCATTCTGACGTGTGGA Chr9:63104807..63104826 59.48 50
upstream ENSMUSE00000503592 Chr9:63083096..63083125 TCTTGGGAGGTTTCCATATCC Chr9:63083100..63083120 60.14 47.62
upstream ENSMUSE00000326412 Chr9:63065146..63065172 No primer for this exon
upstream ENSMUSE00000326384 Chr9:63064800..63064832 TGCAGTGCATTGTTGATGAG Chr9:63064800..63064819 59.41 45
upstream ENSMUSE00000326359 Chr9:63045118..63045179 AGTTCTCGGAGCCGTTTGTA Chr9:63045135..63045154 59.88 50
upstream ENSMUSE00000326330 Chr9:63042009..63042054 No primer for this exon

*** Putative Vector Insertion (Chr 9: 63011998 - 63042008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000502404 Chr9:63011576..63011997 GGCCTGACCCTTTACAATGA Chr9:63011596..63011615 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTAGCTGCTAAGTTCCGCTTA Chr9:63038955..63038977 59.36 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACACTTGCAGACCCCTGTG Chr9:63039004..63039024 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058444