Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28508
Trapped Gene
Cxcl17 (ENSMUSG00000060188)
Vector Insertion
Chr 7: 26185464 - 26187166
Public Clones not available
Private Clones OST29360 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386794 (Chr7:26187167..26187269 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGGAAGCAGTGTCCCTGT Chr7:26187199..26187218 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386794 (Chr7:26187167..26187269 -)
Downstram Exon
ENSMUSE00000338660 (Chr7:26185072..26185463 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGGAAGCAGTGTCCCTGT Chr7:26187199..26187218 60.3 55 CTTCCTGTGGTGCTTTTGGT Chr7:26185419..26185438 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409338 Chr7:26197721..26197905 CTGGTGACAATCCACACAGC Chr7:26197825..26197844 60.16 55
upstream ENSMUSE00000392891 Chr7:26187876..26187956 CTAGGAGGTGGCTCTTGGAA Chr7:26187901..26187920 59.42 55
upstream ENSMUSE00000386794 Chr7:26187167..26187269 CAAGGAAGCAGTGTCCCTGT Chr7:26187199..26187218 60.3 55

*** Putative Vector Insertion (Chr 7: 26185464 - 26187166) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000338660 Chr7:26185072..26185463 CTTCCTGTGGTGCTTTTGGT Chr7:26185419..26185438 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGTCACTAATCGCCTTGC Chr7:26187103..26187123 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAACCGCACTCAGCCCTAT Chr7:26187123..26187143 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060188