Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28513
Trapped Gene
Cryzl1 (ENSMUSG00000058240)
Vector Insertion
Chr 16: 91689586 - 91690161
Public Clones not available
Private Clones OST29153 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708846 (Chr16:91689851..91690160 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGATCTCAGTCGGATGCAC Chr16:91690032..91690051 59.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708846 (Chr16:91689851..91690160 -)
Downstram Exon
ENSMUSE00000716435 (Chr16:91689587..91690160 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGATCTCAGTCGGATGCAC Chr16:91690032..91690051 59.37 55 AATGGCATCAACGGTTTGTT Chr16:91689616..91689635 60.24 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697795 Chr16:91728803..91728871 GCTCTCTGCAGAAGGACTGG Chr16:91728852..91728871 60.28 60
upstream ENSMUSE00000710891 Chr16:91728803..91728868 TCTGCAGAAGGACTGGGAAG Chr16:91728848..91728867 60.52 55
upstream ENSMUSE00000712965 Chr16:91728803..91729047 GTAGTTCCGGGTTCAGTTGC Chr16:91728967..91728986 59.6 55
upstream ENSMUSE00000248331 Chr16:91717649..91717720 No primer for this exon
upstream ENSMUSE00000708836 Chr16:91717649..91717720 No primer for this exon
upstream ENSMUSE00000132148 Chr16:91714994..91715071 TTAAAGCTTGTGCCCTGAGC Chr16:91715009..91715028 60.52 50
upstream ENSMUSE00000132153 Chr16:91712440..91712512 GGATTTCTTCCCTGTTGGAA Chr16:91712467..91712486 58.96 45
upstream ENSMUSE00000132150 Chr16:91709074..91709118 TTTCAGCCAGACGACGAAGT Chr16:91709079..91709098 60.97 50
upstream ENSMUSE00000132149 Chr16:91707470..91707538 GGGCTCTGTGAGGTTATTCG Chr16:91707490..91707509 59.69 55
upstream ENSMUSE00000132151 Chr16:91701317..91701450 AAAGGTGTCATGGACGGAAG Chr16:91701418..91701437 59.97 50
upstream ENSMUSE00000248300 Chr16:91699422..91699533 GTTAGCCCACCACAGAGGAG Chr16:91699491..91699510 59.72 60
upstream ENSMUSE00000248291 Chr16:91695506..91695604 GCTGAAAGCTGTTTGGAGGA Chr16:91695547..91695566 60.52 50
upstream ENSMUSE00000697794 Chr16:91694891..91694910 No primer for this exon
upstream ENSMUSE00000248285 Chr16:91694427..91694545 GGCCATTGGGTAACAACAGA Chr16:91694440..91694459 60.76 50
upstream ENSMUSE00000354156 Chr16:91692844..91692949 TCAAATGCACAACAGGGAAA Chr16:91692852..91692871 60.09 40
upstream ENSMUSE00000364839 Chr16:91690949..91690994 No primer for this exon
upstream ENSMUSE00000708846 Chr16:91689851..91690160 CTGATCTCAGTCGGATGCAC Chr16:91690032..91690051 59.37 55
upstream ENSMUSE00000408995 Chr16:91689705..91690160 AGCCCATCCCACTGTATGAG Chr16:91690127..91690146 59.95 55
upstream ENSMUSE00000716435 Chr16:91689587..91690160 AACAAACCGTTGATGCCATT Chr16:91689638..91689657 60.24 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCCTGACATCTCGAATCA Chr16:91690172..91690192 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCTGACATCTCGAATCA Chr16:91690172..91690192 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058240