Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28519
Trapped Gene
AI481877 (ENSMUSG00000038598)
Vector Insertion
Chr 4: 59056840 - 59060144
Public Clones CMHD-GT_455G3-3 (cmhd)
Private Clones OST28964 (lexicon) OST20995 (lexicon) OST17973 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673566 (Chr4:59060145..59061048 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGTGTCCACCCCTGTCTT Chr4:59060540..59060559 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673566 (Chr4:59060145..59061048 -)
Downstram Exon
ENSMUSE00000673562 (Chr4:59056625..59056839 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGTGTCCACCCCTGTCTT Chr4:59060540..59060559 60 55 AGACGTCGTTTCTTGGGTTG Chr4:59056775..59056794 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673564 Chr4:59151766..59151855 ACGATTGTTGGGAATTGAGC Chr4:59151774..59151793 59.94 45
upstream ENSMUSE00000673563 Chr4:59126770..59126849 TGGCATTGAACGGAAGAACT Chr4:59126815..59126834 60.64 45
upstream ENSMUSE00000673584 Chr4:59126770..59126835 TGGCATTGAACGGAAGAACT Chr4:59126815..59126834 60.64 45
upstream ENSMUSE00000632508 Chr4:59123965..59123985 No primer for this exon
upstream ENSMUSE00000673583 Chr4:59123965..59124076 No primer for this exon
upstream ENSMUSE00000632507 Chr4:59122458..59122539 TGGAGCAGTGGAGAACAAGA Chr4:59122484..59122503 59.54 50
upstream ENSMUSE00000673582 Chr4:59122458..59122539 TGGAGCAGTGGAGAACAAGA Chr4:59122484..59122503 59.54 50
upstream ENSMUSE00000604289 Chr4:59112124..59112302 GTACTACCCCGGAGTGAAAGC Chr4:59112135..59112155 60.01 57.14
upstream ENSMUSE00000604288 Chr4:59107002..59107155 TGTGAATGGTCTCCTGAGCA Chr4:59107075..59107094 60.4 50
upstream ENSMUSE00000604287 Chr4:59106721..59106805 TCCATATGGCTGAGGAGACC Chr4:59106739..59106758 60.03 55
upstream ENSMUSE00000604286 Chr4:59105223..59105373 No primer for this exon
upstream ENSMUSE00000604284 Chr4:59099752..59099853 GCCTTTGTGAACCAGAGTGC Chr4:59099762..59099781 60.84 55
upstream ENSMUSE00000604283 Chr4:59098106..59098214 ATGCCACCAACCCATCTAAT Chr4:59098184..59098203 59.13 45
upstream ENSMUSE00000604282 Chr4:59097123..59097217 TCTTGGGTCTCGTTCTTGCT Chr4:59097128..59097147 59.99 50
upstream ENSMUSE00000673581 Chr4:59095121..59095363 TAACCCTGCAAAAGCAAAGG Chr4:59095259..59095278 60.24 45
upstream ENSMUSE00000527019 Chr4:59094002..59095363 GCTTAGCGTTCCCAGTATGC Chr4:59095014..59095033 59.87 55
upstream ENSMUSE00000673580 Chr4:59089010..59089435 TGGACCTTCTGAGCGAGTTT Chr4:59089092..59089111 59.99 50
upstream ENSMUSE00000673579 Chr4:59085157..59085282 No primer for this exon
upstream ENSMUSE00000673578 Chr4:59084448..59084624 AGAAGCCACAGCGAATCCTA Chr4:59084577..59084596 59.98 50
upstream ENSMUSE00000673577 Chr4:59082085..59082189 ATTCAGGCATGCTGCTCTCT Chr4:59082145..59082164 60.13 50
upstream ENSMUSE00000673576 Chr4:59079224..59079402 TGTGTTAGACTCCCGTTTGG Chr4:59079349..59079368 58.62 50
upstream ENSMUSE00000673575 Chr4:59078022..59078094 TGGACTCAGATGGAGAAAAGC Chr4:59078055..59078075 59.42 47.62
upstream ENSMUSE00000673574 Chr4:59077271..59077340 No primer for this exon
upstream ENSMUSE00000673573 Chr4:59075414..59075592 CACAGTATCGGAGCGGATTT Chr4:59075545..59075564 60.1 50
upstream ENSMUSE00000673572 Chr4:59075098..59075215 CAGAGATACTCCGGCTGCTG Chr4:59075106..59075125 61.1 60
upstream ENSMUSE00000673571 Chr4:59073701..59073812 GGTGACAGTCGACGAGCATA Chr4:59073718..59073737 59.86 55
upstream ENSMUSE00000673570 Chr4:59072466..59072587 TAATGGCACTGTCGTTCCAG Chr4:59072516..59072535 59.72 50
upstream ENSMUSE00000673569 Chr4:59067021..59067114 TCACCTCGCACAGGTTTATG Chr4:59067068..59067087 59.72 50
upstream ENSMUSE00000673568 Chr4:59062141..59062272 ATGACGTCGACGAGAGATCC Chr4:59062187..59062206 60.23 55
upstream ENSMUSE00000673567 Chr4:59061795..59061944 ACTGGCTCCTGATAGCAACG Chr4:59061846..59061865 60.42 55
upstream ENSMUSE00000673566 Chr4:59060145..59061048 CAAGTGTCCACCCCTGTCTT Chr4:59060540..59060559 60 55

*** Putative Vector Insertion (Chr 4: 59056840 - 59060144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673565 Chr4:59056739..59056839 AGACGTCGTTTCTTGGGTTG Chr4:59056775..59056794 60.15 50
downstream ENSMUSE00000673562 Chr4:59056625..59056839 AGACGTCGTTTCTTGGGTTG Chr4:59056775..59056794 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCTTTAATCGCCTTGCAG Chr4:59057079..59057099 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGTGTGGGAGACCTTCGT Chr4:59057090..59057110 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038598