Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28520
Trapped Gene
Lhb (ENSMUSG00000038194)
Vector Insertion
Chr 7: 52676753 - 52676905
Public Clones not available
Private Clones OST28960 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406696 (Chr7:52676585..52676752 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTTCTGCCCAGTCTGCAT Chr7:52676690..52676709 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406696 (Chr7:52676585..52676752 +)
Downstram Exon
ENSMUSE00000268187 (Chr7:52676906..52677224 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTTCTGCCCAGTCTGCAT Chr7:52676690..52676709 60.42 55 GACCCCCACAGTCAGAGCTA Chr7:52677092..52677111 60.26 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594761 Chr7:52676316..52676337 No primer for this exon
upstream ENSMUSE00000406696 Chr7:52676585..52676752 GAGTTCTGCCCAGTCTGCAT Chr7:52676690..52676709 60.42 55

*** Putative Vector Insertion (Chr 7: 52676753 - 52676905) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268187 Chr7:52676906..52677224 GACCCCCACAGTCAGAGCTA Chr7:52677092..52677111 60.26 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr7:52676803..52676823 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTACTGTCCTAGCATGGTG Chr7:52676736..52676757 59.77 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038194