Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28526
Trapped Gene
Tmem134 (ENSMUSG00000024845)
Vector Insertion
Chr 19: 4131076 - 4131228
Public Clones not available
Private Clones OST28888 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434717 (Chr19:4131031..4131075 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434717 (Chr19:4131031..4131075 +)
Downstram Exon
ENSMUSE00000644532 (Chr19:4131229..4131282 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGCACAAAGAAGATGGCACT Chr19:4131259..4131278 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000554572 Chr19:4125987..4126200 GTTCGAGGTGGCTGATGAAG Chr19:4126155..4126174 60.8 55
upstream ENSMUSE00000380485 Chr19:4127057..4127121 No primer for this exon
upstream ENSMUSE00000485451 Chr19:4127550..4127639 GGATTCTGGGCACATGTCTG Chr19:4127550..4127569 61.5 55
upstream ENSMUSE00000145490 Chr19:4127760..4127836 CCCAACATCCTTTGATCCAG Chr19:4127765..4127784 60.31 50
upstream ENSMUSE00000434717 Chr19:4131031..4131075 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4131076 - 4131228) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644532 Chr19:4131229..4131282 GGCACAAAGAAGATGGCACT Chr19:4131259..4131278 60.26 50
downstream ENSMUSE00000472768 Chr19:4131362..4131727 CCAGGTGTAGGTTGGAGGAA Chr19:4131534..4131553 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCCCAACTCCCCACTAAT Chr19:4131111..4131131 60.18 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGGTGAGTGTCCTTCCT Chr19:4131072..4131092 59.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024845