Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28533
Trapped Gene
Tmc4 (ENSMUSG00000019734)
Vector Insertion
Chr 7: 3617611 - 3617703
Public Clones not available
Private Clones OST28719 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000401287 (Chr7:3617704..3617782 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000401287 (Chr7:3617704..3617782 -)
Downstram Exon
ENSMUSE00000482557 (Chr7:3617393..3617610 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460543 Chr7:3629026..3629080 No primer for this exon
upstream ENSMUSE00000424574 Chr7:3628166..3628370 No primer for this exon
upstream ENSMUSE00000709716 Chr7:3628166..3628395 No primer for this exon
upstream ENSMUSE00000424571 Chr7:3627028..3627173 No primer for this exon
upstream ENSMUSE00000424566 Chr7:3626452..3626684 No primer for this exon
upstream ENSMUSE00000424560 Chr7:3626189..3626310 No primer for this exon
upstream ENSMUSE00000424553 Chr7:3623565..3623712 No primer for this exon
upstream ENSMUSE00000424539 Chr7:3622876..3623043 No primer for this exon
upstream ENSMUSE00000424533 Chr7:3622540..3622703 No primer for this exon
upstream ENSMUSE00000349320 Chr7:3621517..3621643 No primer for this exon
upstream ENSMUSE00000601559 Chr7:3621176..3621273 No primer for this exon
upstream ENSMUSE00000308117 Chr7:3619043..3619226 No primer for this exon
upstream ENSMUSE00000308111 Chr7:3618650..3618780 No primer for this exon
upstream ENSMUSE00000308108 Chr7:3618421..3618576 No primer for this exon
upstream ENSMUSE00000401287 Chr7:3617704..3617782 No primer for this exon

*** Putative Vector Insertion (Chr 7: 3617611 - 3617703) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482557 Chr7:3617393..3617610 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGTTACGGACGCCTCATC Chr7:3617729..3617749 60.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGTTACGGACGCCTCATC Chr7:3617729..3617749 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019734