Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28540
Trapped Gene
Nt5dc2 (ENSMUSG00000071547)
Vector Insertion
Chr 14: 31951860 - 31951966
Public Clones not available
Private Clones OST28440 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000618793 (Chr14:31951795..31951859 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCTACCTGGATGAAGGA Chr14:31951825..31951844 60.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000618793 (Chr14:31951795..31951859 +)
Downstram Exon
ENSMUSE00000562663 (Chr14:31951967..31952307 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCTACCTGGATGAAGGA Chr14:31951825..31951844 60.21 55 GAATAGGGCCTTTGTGATGC Chr14:31951991..31952010 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000618796 Chr14:31948039..31948109 CCGGGACATCTTGATAGAGC Chr14:31948082..31948101 59.65 55
upstream ENSMUSE00000562679 Chr14:31948216..31948290 AGGGGATCCGGAAGTATGAC Chr14:31948223..31948242 60.15 55
upstream ENSMUSE00000381406 Chr14:31948524..31948579 TACAACTGGGAACGGCCTAC Chr14:31948558..31948577 59.99 55
upstream ENSMUSE00000237309 Chr14:31948680..31948773 CTACCAGATGAGCGGCTTCT Chr14:31948746..31948765 59.6 55
upstream ENSMUSE00000237302 Chr14:31948872..31949000 ACATCTTCTCGCTCCCAGAG Chr14:31948897..31948916 59.56 55
upstream ENSMUSE00000237296 Chr14:31949104..31949164 GTGCATGTAAAGGGCCTCAT Chr14:31949119..31949138 59.96 50
upstream ENSMUSE00000237290 Chr14:31949251..31949353 CCAACAGTCCCTTCAGCTTT Chr14:31949332..31949351 59.33 50
upstream ENSMUSE00000237367 Chr14:31949454..31949555 CCAACTTTTTCACCGACAGG Chr14:31949531..31949550 60.52 50
upstream ENSMUSE00000237355 Chr14:31949782..31949863 CCACTGGGACCGTATCACTC Chr14:31949815..31949834 60.39 60
upstream ENSMUSE00000618795 Chr14:31951310..31951396 CGTGTGCTCTACTTCGGTGA Chr14:31951355..31951374 60.05 55
upstream ENSMUSE00000618794 Chr14:31951518..31951658 CATCATCAACACGGAGCAGT Chr14:31951583..31951602 59.71 50
upstream ENSMUSE00000618793 Chr14:31951795..31951859 CTGGCTACCTGGATGAAGGA Chr14:31951825..31951844 60.21 55

*** Putative Vector Insertion (Chr 14: 31951860 - 31951966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562663 Chr14:31951967..31952307 GAATAGGGCCTTTGTGATGC Chr14:31951991..31952010 59.53 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCAGCCATAGCAGAGAGC Chr14:31951870..31951890 59.89 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCAGCCATAGCAGAGAGC Chr14:31951870..31951890 59.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071547