Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28541
Trapped Gene
1700081D17Rik (ENSMUSG00000022085)
Vector Insertion
Chr 14: 70448280 - 70459403
Public Clones CMHD-GT_389H10-3 (cmhd)
Private Clones OST28437 (lexicon) OST27757 (lexicon) OST22015 (lexicon) OST21223 (lexicon)
OST20501 (lexicon) OST17529 (lexicon) OST6883 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000123438 (Chr14:70448166..70448279 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCGCTACCAGTTCTTTGTC Chr14:70448204..70448224 59.79 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000123438 (Chr14:70448166..70448279 +)
Downstram Exon
ENSMUSE00000381853 (Chr14:70459404..70459686 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCGCTACCAGTTCTTTGTC Chr14:70448204..70448224 59.79 52.38 GTGCTTGTGTCGGGATCTCT Chr14:70459467..70459486 60.27 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495288 Chr14:70240227..70240388 CCCAGGAGAGAACAACGGTA Chr14:70240349..70240368 60.1 55
upstream ENSMUSE00000123434 Chr14:70247290..70247498 GAGGATGTTTTCTCCCACCA Chr14:70247450..70247469 59.9 50
upstream ENSMUSE00000263557 Chr14:70251435..70251561 GTCAAGTTCCACACGGCTTT Chr14:70251538..70251557 60.16 50
upstream ENSMUSE00000263550 Chr14:70363247..70363345 GGTTGGTGTCCAACATCACA Chr14:70363326..70363345 60.27 50
upstream ENSMUSE00000123439 Chr14:70445684..70445729 GGTGCTGACATGAAAAGTGG Chr14:70445684..70445703 59.14 50
upstream ENSMUSE00000123438 Chr14:70448166..70448279 CACCGCTACCAGTTCTTTGTC Chr14:70448204..70448224 59.79 52.38

*** Putative Vector Insertion (Chr 14: 70448280 - 70459403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381853 Chr14:70459404..70459686 GTGCTTGTGTCGGGATCTCT Chr14:70459467..70459486 60.27 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGATTGTGGGGCAGTAAT Chr14:70457315..70457335 58.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTTGCTCTGATCTCGTG Chr14:70457304..70457324 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022085