Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28546
Trapped Gene
Rufy1 (ENSMUSG00000020375)
Vector Insertion
Chr 11: 50203461 - 50203795
Public Clones CMHD-GT_457A2-3 (cmhd)
Private Clones OST28311 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103934 (Chr11:50203796..50203873 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103934 (Chr11:50203796..50203873 -)
Downstram Exon
ENSMUSE00000383398 (Chr11:50202805..50203460 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000373659 Chr11:50244286..50244613 No primer for this exon
upstream ENSMUSE00000369809 Chr11:50235132..50235305 No primer for this exon
upstream ENSMUSE00000103930 Chr11:50233879..50233996 No primer for this exon
upstream ENSMUSE00000458747 Chr11:50233123..50233224 No primer for this exon
upstream ENSMUSE00000103909 Chr11:50230686..50230809 No primer for this exon
upstream ENSMUSE00000103919 Chr11:50229742..50229803 No primer for this exon
upstream ENSMUSE00000103920 Chr11:50228019..50228084 No primer for this exon
upstream ENSMUSE00000103926 Chr11:50224068..50224137 No primer for this exon
upstream ENSMUSE00000103906 Chr11:50221325..50221426 No primer for this exon
upstream ENSMUSE00000103914 Chr11:50219869..50219985 No primer for this exon
upstream ENSMUSE00000103925 Chr11:50217956..50218123 No primer for this exon
upstream ENSMUSE00000103933 Chr11:50214940..50215037 No primer for this exon
upstream ENSMUSE00000103928 Chr11:50211873..50211992 No primer for this exon
upstream ENSMUSE00000103936 Chr11:50211146..50211275 No primer for this exon
upstream ENSMUSE00000103923 Chr11:50208423..50208517 No primer for this exon
upstream ENSMUSE00000103913 Chr11:50205521..50205569 No primer for this exon
upstream ENSMUSE00000103934 Chr11:50203796..50203873 No primer for this exon

*** Putative Vector Insertion (Chr 11: 50203461 - 50203795) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383398 Chr11:50202805..50203460 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:50203725..50203745 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTTTCACTACGTGACTGG Chr11:50203735..50203756 59.79 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020375