Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2855
Trapped Gene
Rras2 (ENSMUSG00000055723)
Vector Insertion
Chr 7: 121203934 - 121260909
Public Clones (sanger) AF0468 (sanger) RRU621 (baygenomics) IST13619D5 (tigm) IST15057B3 (tigm)
IST13064C3 (tigm) IST14806G6 (tigm)
Private Clones OST428094 (lexicon) OST361011 (lexicon) OST68765 (lexicon) OST68744 (lexicon)
OST67358 (lexicon) OST57123 (lexicon) OST47398 (lexicon) OST42794 (lexicon)
OST37308 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000588859 (Chr7:121260910..121261295 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCACCATCCAGTTCATCC Chr7:121260912..121260931 60.48 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000588859 (Chr7:121260910..121261295 -)
Downstram Exon
ENSMUSE00000527809 (Chr7:121203846..121203933 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCACCATCCAGTTCATCC Chr7:121260912..121260931 60.48 55 TCGGTCATCGATCACACATT Chr7:121203840..121203859 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000588859 Chr7:121260910..121261295 GCTCACCATCCAGTTCATCC Chr7:121260912..121260931 60.48 55

*** Putative Vector Insertion (Chr 7: 121203934 - 121260909) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000527809 Chr7:121203846..121203933 TCGGTCATCGATCACACATT Chr7:121203840..121203859 59.92 45
downstream ENSMUSE00000527808 Chr7:121202441..121202543 ACTCCTCTTGTCCGGCTGTA Chr7:121202495..121202514 59.87 55
downstream ENSMUSE00000527807 Chr7:121202054..121202162 GGAAACTCATCACGGTCCTT Chr7:121202078..121202097 58.99 50
downstream ENSMUSE00000436813 Chr7:121193815..121193933 GAGCTGCCTTGCTAACTGCT Chr7:121193873..121193892 59.93 55
downstream ENSMUSE00000504249 Chr7:121190302..121191765 GGGGACACTGAACGTGACTT Chr7:121190534..121190553 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGCTGGGTGAGATTGAGG Chr7:121251866..121251886 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGCTGGGTGAGATTGAGG Chr7:121251866..121251886 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGATGCATACAGACGCACA Chr7:121252294..121252314 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGATGCATACAGACGCACA Chr7:121252294..121252314 59.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055723