Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28556
Trapped Gene
1810053B01Rik (ENSMUSG00000054582)
Vector Insertion
Chr 2: 163875361 - 163875712
Public Clones not available
Private Clones OST28029 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639311 (Chr2:163875230..163875360 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCGTCTCTACTCCCTCA Chr2:163875231..163875250 59.56 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639311 (Chr2:163875230..163875360 +)
Downstram Exon
ENSMUSE00000429997 (Chr2:163875713..163876255 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCGTCTCTACTCCCTCA Chr2:163875231..163875250 59.56 60 ACACAGAGATCCCCATCAGG Chr2:163876191..163876210 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639323 Chr2:163851217..163851409 TCTGGGCTATGCCTACATCA Chr2:163851369..163851388 59.25 50
upstream ENSMUSE00000639322 Chr2:163853211..163853404 CCTTCGGAAGTCTGGTATGG Chr2:163853293..163853312 59.54 55
upstream ENSMUSE00000639321 Chr2:163856935..163857050 AGGCCATCAACACCATGAAT Chr2:163857005..163857024 60.2 45
upstream ENSMUSE00000639320 Chr2:163857916..163858055 AGGCTCCAGGACCTCTTCTC Chr2:163858028..163858047 59.95 60
upstream ENSMUSE00000639319 Chr2:163858224..163858318 GCTTCGGCTTTGTCAACTTT Chr2:163858275..163858294 59.5 45
upstream ENSMUSE00000639318 Chr2:163860981..163861118 ACATGAATGGGAAGGAGGTG Chr2:163860991..163861010 59.78 50
upstream ENSMUSE00000639317 Chr2:163862847..163862942 TGAAGAACCTGGACGACTCC Chr2:163862863..163862882 60.24 55
upstream ENSMUSE00000639316 Chr2:163868053..163868301 CTCCAGAAGAGGCAACGAAG Chr2:163868105..163868124 60.13 55
upstream ENSMUSE00000639315 Chr2:163869286..163869376 AACTCCAATGCAACCTGACC Chr2:163869324..163869343 59.97 50
upstream ENSMUSE00000639314 Chr2:163870000..163870116 CAGCATCCCTGTATCCACCT Chr2:163870047..163870066 59.95 55
upstream ENSMUSE00000639313 Chr2:163871599..163871705 TTCTCGTGCCACATAGAGGA Chr2:163871659..163871678 59.39 50
upstream ENSMUSE00000639312 Chr2:163873217..163873310 CACCCCTACACGAGCAAAAG Chr2:163873281..163873300 60.68 55
upstream ENSMUSE00000639311 Chr2:163875230..163875360 GGAGCGTCTCTACTCCCTCA Chr2:163875231..163875250 59.56 60

*** Putative Vector Insertion (Chr 2: 163875361 - 163875712) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000429997 Chr2:163875713..163876255 ACACAGAGATCCCCATCAGG Chr2:163876191..163876210 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACCAAGGGCTGTCCTAGA Chr2:163875392..163875412 58.89 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTGTCCTAGACGTGACT Chr2:163875399..163875419 59.33 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054582