Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28565
Trapped Gene
Ctrb1 (ENSMUSG00000031957)
Vector Insertion
Chr 8: 114210649 - 114211000
Public Clones not available
Private Clones OST27792 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307035 (Chr8:114211001..114211134 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGTGTCCGAGGCTAAGTG Chr8:114211074..114211093 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307035 (Chr8:114211001..114211134 -)
Downstram Exon
ENSMUSE00000307027 (Chr8:114210419..114210648 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGTGTCCGAGGCTAAGTG Chr8:114211074..114211093 60.28 55 GTCCAGACTCCGTCCTTCTG Chr8:114210580..114210599 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214948 Chr8:114214841..114214910 CATTCCTTTGGCTTGTGTCC Chr8:114214869..114214888 60.49 50
upstream ENSMUSE00000307050 Chr8:114213397..114213500 CGTCAACGGAGAGGATGCTA Chr8:114213432..114213451 61.34 55
upstream ENSMUSE00000214949 Chr8:114213225..114213304 CTCCCTCATCAGCGAAAACT Chr8:114213256..114213275 59.43 50
upstream ENSMUSE00000214951 Chr8:114213041..114213119 AGGTCCTGAAAATCGCTCAG Chr8:114213041..114213060 59.43 50
upstream ENSMUSE00000214947 Chr8:114212445..114212625 ACTCCTTCACCGTGCGTAAT Chr8:114212584..114212603 59.62 50
upstream ENSMUSE00000307035 Chr8:114211001..114211134 ATCGTGTCCGAGGCTAAGTG Chr8:114211074..114211093 60.28 55

*** Putative Vector Insertion (Chr 8: 114210649 - 114211000) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307027 Chr8:114210419..114210648 GTCCAGACTCCGTCCTTCTG Chr8:114210580..114210599 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACAGACCTGCCTAACCTG Chr8:114210949..114210969 58.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACAGACCTGCCTAACCTG Chr8:114210949..114210969 58.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031957