Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28572
Trapped Gene
Adamts2 (ENSMUSG00000036545)
Vector Insertion
Chr 11: 50610031 - 50617070
Public Clones not available
Private Clones OST27658 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000295764 (Chr11:50609941..50610030 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGATCCCTCCAAGAAGAGC Chr11:50609950..50609969 58.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000295764 (Chr11:50609941..50610030 +)
Downstram Exon
ENSMUSE00000349744 (Chr11:50617071..50617551 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGATCCCTCCAAGAAGAGC Chr11:50609950..50609969 58.97 55 GGATGGAGCAGTAGCGAGAC Chr11:50617142..50617161 59.98 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000295779 Chr11:50415587..50415801 GCTCTACTGCTGCTGCTGCT Chr11:50415708..50415727 61.19 60
upstream ENSMUSE00000295772 Chr11:50416739..50417133 GGGAGCTGTCTCTACGTTGG Chr11:50417056..50417075 59.87 60
upstream ENSMUSE00000295927 Chr11:50481493..50481652 GGATCAGGAGGCTGAACAAG Chr11:50481555..50481574 59.8 55
upstream ENSMUSE00000295834 Chr11:50550668..50550870 ATGACTCGGTGGTCCAGTTC Chr11:50550803..50550822 59.97 55
upstream ENSMUSE00000295914 Chr11:50570198..50570281 ACATCAATGTGGTGCTGGTG Chr11:50570235..50570254 60.45 50
upstream ENSMUSE00000295904 Chr11:50586719..50586875 CTTTCTCACACGGCAGGATT Chr11:50586835..50586854 60.26 50
upstream ENSMUSE00000580012 Chr11:50588816..50588921 CCTGTCCGCAGCTGTACTCT Chr11:50588845..50588864 60.61 60
upstream ENSMUSE00000580011 Chr11:50589621..50589764 GGTACAGGCTGCCTTCCATC Chr11:50589696..50589715 61.95 60
upstream ENSMUSE00000580010 Chr11:50590124..50590256 TTCCATGAACGAGCAGTGTC Chr11:50590199..50590218 59.84 50
upstream ENSMUSE00000580009 Chr11:50590633..50590746 AAGACAAAGAAGGGTCCTCCA Chr11:50590696..50590716 60.1 47.62
upstream ENSMUSE00000295870 Chr11:50593195..50593340 CCCGATATCCTCAAACGAGA Chr11:50593228..50593247 60.03 50
upstream ENSMUSE00000295865 Chr11:50595207..50595382 TGGGACCTGTACTTTGAGCA Chr11:50595319..50595338 59.29 50
upstream ENSMUSE00000295860 Chr11:50598105..50598238 ATGGAACACGCTGCTCCTAC Chr11:50598180..50598199 60.28 55
upstream ENSMUSE00000295852 Chr11:50599050..50599173 GAGGTCACCGAGGAAACAAG Chr11:50599154..50599173 59.7 55
upstream ENSMUSE00000295845 Chr11:50600088..50600168 GAGCCAGACACCTGCTCATC Chr11:50600118..50600137 60.99 60
upstream ENSMUSE00000295841 Chr11:50600691..50600857 TGGGAATACAGGAACGAGGA Chr11:50600783..50600802 60.45 50
upstream ENSMUSE00000353160 Chr11:50602157..50602316 CACGAGGACTCCCTCAATGT Chr11:50602208..50602227 60.11 55
upstream ENSMUSE00000295809 Chr11:50605305..50605437 ATGGTACACCGAGCCTTCTG Chr11:50605352..50605371 60.13 55
upstream ENSMUSE00000295804 Chr11:50606148..50606355 CAAACACTGCAACGATCACC Chr11:50606265..50606284 60.16 50
upstream ENSMUSE00000295794 Chr11:50608820..50608949 TCTGTCGCACTGCAGATGAT Chr11:50608863..50608882 60.59 50
upstream ENSMUSE00000295764 Chr11:50609941..50610030 CAGATCCCTCCAAGAAGAGC Chr11:50609950..50609969 58.97 55

*** Putative Vector Insertion (Chr 11: 50610031 - 50617070) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000349744 Chr11:50617071..50617551 GGATGGAGCAGTAGCGAGAC Chr11:50617142..50617161 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCCTGTGCTTGTCTGAG Chr11:50610058..50610078 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCTTGTCTGAGGGATCGT Chr11:50610065..50610085 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036545