Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28589
Trapped Gene
CT010490.10 (ENSMUSG00000063427)
Vector Insertion
Chr 16: 20822256 - 20822311
Public Clones not available
Private Clones OST27187 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000561196 (Chr16:20822312..20822713 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGATTGCCATCTACGAACT Chr16:20822673..20822692 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000561196 (Chr16:20822312..20822713 -)
Downstram Exon
ENSMUSE00000644888 (Chr16:20822193..20822255 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGATTGCCATCTACGAACT Chr16:20822673..20822692 60.1 50 GACCACGTCCATGACCAAAG Chr16:20822208..20822227 61.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561196 Chr16:20822312..20822713 CGGATTGCCATCTACGAACT Chr16:20822673..20822692 60.1 50

*** Putative Vector Insertion (Chr 16: 20822256 - 20822311) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644888 Chr16:20822193..20822255 GACCACGTCCATGACCAAAG Chr16:20822208..20822227 61.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCCGACAAGAAAGCTGAG Chr16:20822289..20822309 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCCGACAAGAAAGCTGAG Chr16:20822289..20822309 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063427