Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2859
Trapped Gene
Zfp462 (ENSMUSG00000060206)
Vector Insertion
Chr 4: 54961105 - 55020404
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
AF0401 (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) AD0173 (sanger) (sanger) (sanger) (sanger) (sanger)
YTC751 (baygenomics) XG155 (baygenomics) 5SD049A05 (ggtc) 5SD034B03 (ggtc)
3SE028E10 (ggtc) 3SD170C04 (ggtc) 5SD091H05 (ggtc) (ggtc)
3SE113D07 (ggtc) 5SE068B05 (ggtc) 5SD178C07 (ggtc) 5SP095H04 (ggtc)
(ggtc) (ggtc) 5SP144B09 (ggtc) 5SE085C02 (ggtc) 3SD021A07 (ggtc)
3SD173F08 (ggtc) 3SD139C08 (ggtc) (ggtc) (ggtc) 3SD049A05 (ggtc)
3SD034B03 (ggtc) 3SE020D07 (ggtc) 3SD164C08 (ggtc) 3SD091H05 (ggtc)
(ggtc) 3SE090C03 (ggtc) 5SD026C11 (ggtc) 3SD178C07 (ggtc) 3SD141G01 (ggtc)
(ggtc) (ggtc) 5SP140G10 (ggtc) 5SD039G05 (ggtc) 3SE031F10 (ggtc)
5SD170C04 (ggtc) 5SD123H02 (ggtc) (ggtc) 5SE120E03 (ggtc) 3SE080D03 (ggtc)
3SE003C01 (ggtc) 5SD160F10 (ggtc) (ggtc) 5SE086C03 (ggtc) 5SD021A07 (ggtc)
5SD173F08 (ggtc) 5SD139C08 (ggtc) (ggtc) (ggtc) CMHD-GT_525C5-5S (cmhd)
IST14900B8 (tigm) IST14325A3 (tigm) IST15005D11 (tigm) IST10963B5 (tigm)
IST10673D4 (tigm) IST14614G4 (tigm) IST10198A11 (tigm) IST11534C10 (tigm)
IST10418A10 (tigm) IST14452F4 (tigm) IST10963B5 (tigm) IST15024A2 (tigm)
IST14307E7 (tigm) IST14566A3 (tigm) IST11102B7 (tigm) IST11530C10 (tigm)
IST10714G6 (tigm) IST12815B12 (tigm) IST14151B1 (tigm) IST10033C12 (tigm)
IST10461E12 (tigm) IST12819F9 (tigm) IST14676H4 (tigm) IST15054B4 (tigm)
IST14337A10 (tigm) IST14102F10 (tigm) IST12932H7 (tigm) IST12051G10 (tigm)
IST14164F9 (tigm) IST14392B3 (tigm) IST12015E7 (tigm) IST14456D1 (tigm)
IST10714G6 (tigm) IST14520F8 (tigm) IST14141A2 (tigm) IST10566H9 (tigm)
IST10195F9 (tigm) IST11200F3 (tigm) IST11535E8 (tigm) IST13027E1 (tigm)
IST14555C1 (tigm) IST14190E1 (tigm) IST13217A11 (tigm) IST10545E9 (tigm)
IST10439D11 (tigm) IST10876H3 (tigm) IST14637D5 (tigm) IST14794G1 (tigm)
IST10795F3 (tigm)
Private Clones OST459052 (lexicon) OST413379 (lexicon) OST168162 (lexicon) OST132439 (lexicon)
OST118694 (lexicon) OST65117 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673985 (Chr4:54960817..54961104 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAATAACCCGAGCAGGAAGA Chr4:54961008..54961027 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673985 (Chr4:54960817..54961104 +)
Downstram Exon
ENSMUSE00000487524 (Chr4:55020405..55020654 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAATAACCCGAGCAGGAAGA Chr4:54961008..54961027 60.21 50 CCCAGATAGTGGCTCGTCAT Chr4:55020578..55020597 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673985 Chr4:54960817..54961104 CAATAACCCGAGCAGGAAGA Chr4:54961008..54961027 60.21 50

*** Putative Vector Insertion (Chr 4: 54961105 - 55020404) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487524 Chr4:55020405..55020654 CCCAGATAGTGGCTCGTCAT Chr4:55020578..55020597 60.1 55
downstream ENSMUSE00000632627 Chr4:55021128..55026721 GCAAGTTGTCGCAGAATGAA Chr4:55022777..55022796 59.99 45
downstream ENSMUSE00000527230 Chr4:55024238..55026721 GATCACCTTGTTGGGCTTGT Chr4:55026109..55026128 59.97 50
downstream ENSMUSE00000632619 Chr4:55024352..55026721 GATCACCTTGTTGGGCTTGT Chr4:55026109..55026128 59.97 50
downstream ENSMUSE00000527229 Chr4:55027555..55027719 TCCTTGATCTTTGGCACCTC Chr4:55027595..55027614 60.19 50
downstream ENSMUSE00000673956 Chr4:55029686..55029972 ACATTGCATCAAGCAAGCAG Chr4:55029803..55029822 60.02 45
downstream ENSMUSE00000673961 Chr4:55029689..55029972 ACATTGCATCAAGCAAGCAG Chr4:55029803..55029822 60.02 45
downstream ENSMUSE00000527228 Chr4:55029869..55029972 TGGCAGCTGTACTTGTCCTC Chr4:55029942..55029961 59.04 55
downstream ENSMUSE00000360129 Chr4:55032961..55033079 CGGCTGTTGTAGGAGGACTT Chr4:55033050..55033069 59.35 55
downstream ENSMUSE00000179018 Chr4:55036287..55036478 CATGGACCTTGAGGGAATGT Chr4:55036373..55036392 59.78 50
downstream ENSMUSE00000179012 Chr4:55063058..55063325 TAACGCGGCTCTTGTTTCTT Chr4:55063147..55063166 60.02 45
downstream ENSMUSE00000179016 Chr4:55064063..55064199 TGCAGCACTATGTGGTCGAT Chr4:55064197..55064216 60.3 50
downstream ENSMUSE00000179014 Chr4:55072886..55073109 AGTTTGGAACGGCACACTTC Chr4:55072928..55072947 60.16 50
downstream ENSMUSE00000179000 Chr4:55085845..55085977 GCTCATTTCGTCGTCCTTGT Chr4:55085961..55085980 60.26 50
downstream ENSMUSE00000179008 Chr4:55092136..55092259 CACGTGTCTTTCCCACTCAG Chr4:55092248..55092267 59.31 55
downstream ENSMUSE00000604453 Chr4:55093538..55096434 TAAACATGTGGCCAACGAAA Chr4:55094654..55094673 59.97 40
downstream ENSMUSE00000632620 Chr4:55093538..55094230 AGATCCGGAAGGAAGGATGT Chr4:55093992..55094011 59.9 50
downstream ENSMUSE00000673955 Chr4:55093538..55094202 AGATCCGGAAGGAAGGATGT Chr4:55093992..55094011 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:54976155..54976175 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTAGTTCTTGGGGGACAGC Chr4:54976075..54976096 60.12 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060206