Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28595
Trapped Gene
Ppp1r1a (ENSMUSG00000022490)
Vector Insertion
Chr 15: 103363926 - 103364780
Public Clones not available
Private Clones OST26752 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000127594 (Chr15:103364781..103364841 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000127594 (Chr15:103364781..103364841 -)
Downstram Exon
ENSMUSE00000127595 (Chr15:103363888..103363925 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGGATCCGGTCTTCATCTA Chr15:103363881..103363900 61.18 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334947 Chr15:103368226..103368423 ACGGAAGATCCAGTTTACGG Chr15:103368270..103368289 59.05 50
upstream ENSMUSE00000127594 Chr15:103364781..103364841 No primer for this exon

*** Putative Vector Insertion (Chr 15: 103363926 - 103364780) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127595 Chr15:103363888..103363925 GGGGATCCGGTCTTCATCTA Chr15:103363881..103363900 61.18 55
downstream ENSMUSE00000127593 Chr15:103363469..103363532 GGGTGTGGTCCTTGTCATCT Chr15:103363457..103363476 59.82 55
downstream ENSMUSE00000127596 Chr15:103362757..103362912 TGTTCAACCATCGTCTGGAG Chr15:103362869..103362888 59.68 50
downstream ENSMUSE00000273077 Chr15:103361785..103361891 TGTGGGCTGAAGAATCCTCT Chr15:103361795..103361814 59.8 50
downstream ENSMUSE00000678015 Chr15:103360710..103361380 GCAGCAGTCTCCCAAGTAGG Chr15:103361008..103361027 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGGATGGGTGCTAGAGAG Chr15:103364744..103364764 60.61 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATCAGTCCTCCCCAGGTA Chr15:103364776..103364796 60.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022490