Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28602
Trapped Gene
AC132586.3 (ENSMUSG00000055452)
Vector Insertion
Chr 7: 3110170 - 3110217
Public Clones not available
Private Clones OST26539 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000252752 (Chr7:3110218..3111874 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGGTGGCTTCAGTCAGA Chr7:3111075..3111094 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000252752 (Chr7:3110218..3111874 -)
Downstram Exon
ENSMUSE00000333351 (Chr7:3108535..3110169 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGGTGGCTTCAGTCAGA Chr7:3111075..3111094 60.02 55 CCTTGTACAGAACCCCTCCA Chr7:3110032..3110051 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459142 Chr7:3111905..3111950 No primer for this exon
upstream ENSMUSE00000252752 Chr7:3110218..3111874 CAGTGGTGGCTTCAGTCAGA Chr7:3111075..3111094 60.02 55

*** Putative Vector Insertion (Chr 7: 3110170 - 3110217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333351 Chr7:3108535..3110169 CCTTGTACAGAACCCCTCCA Chr7:3110032..3110051 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCAGGTGTCCTACTTCC Chr7:3110197..3110217 59.58 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGCAGGTGTCCTACTTCC Chr7:3110197..3110217 59.58 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055452