Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28614
Trapped Gene
Spata16 (ENSMUSG00000039335)
Vector Insertion
Chr 3: 26826402 - 26881841
Public Clones not available
Private Clones OST25862 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676255 (Chr3:26826228..26826401 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATAAGGAGCGTGTGTGGA Chr3:26826278..26826297 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676255 (Chr3:26826228..26826401 +)
Downstram Exon
ENSMUSE00000393163 (Chr3:26881842..26882136 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATAAGGAGCGTGTGTGGA Chr3:26826278..26826297 60.26 50 CAGAGGCTACAGACCCCAAC Chr3:26882023..26882042 59.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337927 Chr3:26536553..26536659 TGGTAGTCACTCGGCTCCTC Chr3:26536622..26536641 60.41 60
upstream ENSMUSE00000676256 Chr3:26536572..26536659 TGGTAGTCACTCGGCTCCTC Chr3:26536622..26536641 60.41 60
upstream ENSMUSE00000380731 Chr3:26566236..26566868 AGGCTGACAGCGAAGAGAAG Chr3:26566507..26566526 59.89 55
upstream ENSMUSE00000720957 Chr3:26566236..26566868 AGGCTGACAGCGAAGAGAAG Chr3:26566507..26566526 59.89 55
upstream ENSMUSE00000302030 Chr3:26631712..26631857 CTTTGAAGCACACGCTGAAG Chr3:26631744..26631763 59.78 50
upstream ENSMUSE00000302022 Chr3:26676427..26676516 TTTCCGAAACCATCTTCGTC Chr3:26676451..26676470 60.05 45
upstream ENSMUSE00000302015 Chr3:26739577..26739661 TTGCGGACTACATGTTCTGG Chr3:26739588..26739607 59.72 50
upstream ENSMUSE00000302006 Chr3:26777485..26777632 CGGTTATGTACACGCCCTTT Chr3:26777525..26777544 59.88 50
upstream ENSMUSE00000301999 Chr3:26812109..26812255 CTGCTGACACTTGGGTTCAA Chr3:26812174..26812193 59.87 50
upstream ENSMUSE00000301994 Chr3:26813626..26813738 TATCCGGAGCACACAACTGA Chr3:26813717..26813736 60.26 50
upstream ENSMUSE00000301985 Chr3:26823153..26823317 CTGCTCAGGTGTGATGGAGA Chr3:26823167..26823186 59.98 55
upstream ENSMUSE00000349976 Chr3:26826228..26826311 TGATAAGGAGCGTGTGTGGA Chr3:26826278..26826297 60.26 50
upstream ENSMUSE00000676255 Chr3:26826228..26826401 TGATAAGGAGCGTGTGTGGA Chr3:26826278..26826297 60.26 50

*** Putative Vector Insertion (Chr 3: 26826402 - 26881841) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393163 Chr3:26881842..26882136 CAGAGGCTACAGACCCCAAC Chr3:26882023..26882042 59.72 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAATCGCCTTGCAGCACAT Chr3:26847451..26847472 63.31 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAAGTTCGTGACTGGGAAA Chr3:26847446..26847466 61.2 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039335