Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28638
Trapped Gene
AC158220.4-201 (ENSMUSG00000047730)
Vector Insertion
Chr 7: 28902604 - 28905338
Public Clones not available
Private Clones OST24748 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465827 (Chr7:28902220..28902603 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAACAACGGTCTGACATGC Chr7:28902272..28902291 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465827 (Chr7:28902220..28902603 +)
Downstram Exon
ENSMUSE00000464040 (Chr7:28905339..28905610 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAACAACGGTCTGACATGC Chr7:28902272..28902291 60.16 50 CTATCGGTGTCTTCCCCTGA Chr7:28905582..28905601 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000256202 Chr7:28887802..28888246 TGGCACCCTCAATACCTACC Chr7:28887905..28887924 59.81 55
upstream ENSMUSE00000535496 Chr7:28888571..28889187 TTCAATGTCACCGTGGCTAA Chr7:28889065..28889084 60.11 45
upstream ENSMUSE00000388316 Chr7:28889684..28890227 AGAATCCCAACGATGACCTG Chr7:28889874..28889893 59.93 50
upstream ENSMUSE00000454620 Chr7:28891057..28891628 CCTATGAGGAGTGCCGGATA Chr7:28891354..28891373 60.05 55
upstream ENSMUSE00000471213 Chr7:28891940..28892513 CTTCCGCCAATGTGTGTATG Chr7:28892377..28892396 59.99 50
upstream ENSMUSE00000510737 Chr7:28898947..28899146 GTGTGAGTGCGATGACCACT Chr7:28899056..28899075 59.74 55
upstream ENSMUSE00000465827 Chr7:28902220..28902603 CAAACAACGGTCTGACATGC Chr7:28902272..28902291 60.16 50

*** Putative Vector Insertion (Chr 7: 28902604 - 28905338) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464040 Chr7:28905339..28905610 CTATCGGTGTCTTCCCCTGA Chr7:28905582..28905601 60.06 55
downstream ENSMUSE00000535487 Chr7:28905715..28905877 GAGCAGGTCTTGATGCCTTC Chr7:28905765..28905784 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCTTTCCTTCTCTCGTG Chr7:28902639..28902659 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047730