Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28642
Trapped Gene
Gnrh1 (ENSMUSG00000015812)
Vector Insertion
Chr 14: 68365956 - 68367306
Public Clones not available
Private Clones OST24650 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000123235 (Chr14:68365860..68365955 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000123235 (Chr14:68365860..68365955 +)
Downstram Exon
ENSMUSE00000647798 (Chr14:68367307..68367410 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343480 Chr14:68364327..68364537 No primer for this exon
upstream ENSMUSE00000123235 Chr14:68365860..68365955 No primer for this exon

*** Putative Vector Insertion (Chr 14: 68365956 - 68367306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000647798 Chr14:68367307..68367410 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACTTTGGATAATCGCCTTG Chr14:68365997..68366018 60.81 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAAAAGGACTTTGGACGTG Chr14:68365991..68366011 60.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015812