Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28649
Trapped Gene
Gipc2 (ENSMUSG00000039131)
Vector Insertion
Chr 3: 151771012 - 151790999
Public Clones not available
Private Clones OST24386 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000260054 (Chr3:151791000..151791180 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTGGGGGATCATATCGAA Chr3:151791118..151791137 60.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000260054 (Chr3:151791000..151791180 -)
Downstram Exon
ENSMUSE00000260047 (Chr3:151770905..151771011 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTGGGGGATCATATCGAA Chr3:151791118..151791137 60.55 50 GTTGATGTCTTTCCGGCTTT Chr3:151770953..151770972 59.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346457 Chr3:151828612..151828875 GAGCTCTACGCCAAGATTGC Chr3:151828640..151828659 60.12 55
upstream ENSMUSE00000260059 Chr3:151800537..151800722 TCATATTTGCCCACGTGAAA Chr3:151800627..151800646 59.93 40
upstream ENSMUSE00000260054 Chr3:151791000..151791180 GTGTGGGGGATCATATCGAA Chr3:151791118..151791137 60.55 50

*** Putative Vector Insertion (Chr 3: 151771012 - 151790999) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260047 Chr3:151770905..151771011 GTTGATGTCTTTCCGGCTTT Chr3:151770953..151770972 59.17 45
downstream ENSMUSE00000260044 Chr3:151765583..151765664 TCATCAACCTTTCCGATTGC Chr3:151765602..151765621 60.98 45
downstream ENSMUSE00000394566 Chr3:151756807..151757259 CCCAGAGTCTCGTCAAGAGC Chr3:151757162..151757181 60.13 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACTCCCTGGACTCTCTTGA Chr3:151775952..151775973 59.97 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACTCCCTGGACTCTCTTGA Chr3:151775952..151775973 59.97 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039131