Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2865
Trapped Gene
Pvr (ENSMUSG00000040511)
Vector Insertion
Chr 7: 20504259 - 20506301
Public Clones AF0365 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000355337 (Chr7:20506302..20506462 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGCTGTTCTGCTATGCAC Chr7:20506314..20506333 59.78 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000355337 (Chr7:20506302..20506462 -)
Downstram Exon
ENSMUSE00000230075 (Chr7:20503911..20504258 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGCTGTTCTGCTATGCAC Chr7:20506314..20506333 59.78 55 AAGTTCGAGATGGCCAGAGA Chr7:20503978..20503997 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355337 Chr7:20506302..20506462 GCTGCTGTTCTGCTATGCAC Chr7:20506314..20506333 59.78 55

*** Putative Vector Insertion (Chr 7: 20504259 - 20506301) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230075 Chr7:20503911..20504258 AAGTTCGAGATGGCCAGAGA Chr7:20503978..20503997 59.95 50
downstream ENSMUSE00000230071 Chr7:20502223..20502519 TTCACGGTGACTTCCATTCA Chr7:20502358..20502377 60.09 45
downstream ENSMUSE00000230066 Chr7:20500087..20500213 GCCAGAGATGGACACGTTTT Chr7:20500163..20500182 60.12 50
downstream ENSMUSE00000230059 Chr7:20495954..20496105 ATTGGTGACTTCGCACACAA Chr7:20495975..20495994 60.16 45
downstream ENSMUSE00000230052 Chr7:20494530..20494652 TACAGCGAGGACAAAGACGA Chr7:20494554..20494573 59.59 50
downstream ENSMUSE00000599092 Chr7:20491128..20491162 TCTCTGAGGGATTGGACTGC Chr7:20491111..20491130 60.35 55
downstream ENSMUSE00000599091 Chr7:20489639..20490541 CAGTCTACAGTCGCCGTTCA Chr7:20490481..20490500 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTGCTGCTGTTCTGCTA Chr7:20506317..20506337 60.64 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTGCTGCTGTTCTGCTA Chr7:20506317..20506337 60.64 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040511