Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28688
Trapped Gene
Snapin (ENSMUSG00000001018)
Vector Insertion
Chr 3: 90293516 - 90294075
Public Clones not available
Private Clones OST23550 (lexicon) OST13661 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672815 (Chr3:90294076..90294194 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672815 (Chr3:90294076..90294194 -)
Downstram Exon
ENSMUSE00000672814 (Chr3:90292922..90293515 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431038 Chr3:90294754..90294923 No primer for this exon
upstream ENSMUSE00000174385 Chr3:90294470..90294516 No primer for this exon
upstream ENSMUSE00000672816 Chr3:90294470..90294714 No primer for this exon
upstream ENSMUSE00000174384 Chr3:90294076..90294194 No primer for this exon
upstream ENSMUSE00000672815 Chr3:90294076..90294194 No primer for this exon
upstream ENSMUSE00000672818 Chr3:90294076..90294350 No primer for this exon

*** Putative Vector Insertion (Chr 3: 90293516 - 90294075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672814 Chr3:90292922..90293515 No primer for this exon
downstream ENSMUSE00000509277 Chr3:90292292..90293515 No primer for this exon
downstream ENSMUSE00000672817 Chr3:90291948..90293515 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCGACGAGTTGTCTTGGT Chr3:90294099..90294119 62.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCGACGAGTTGTCTTGGT Chr3:90294099..90294119 62.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001018