Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28708
Trapped Gene
Psors1c2 (ENSMUSG00000024409)
Vector Insertion
Chr 17: 35670240 - 35670843
Public Clones CMHD-GT_395E11-3 (cmhd) CMHD-GT_466F10-3 (cmhd) CMHD-GT_384F5-3 (cmhd) CMHD-GT_377A2-3 (cmhd)
IST12370E9 (tigm) IST10297E12 (tigm) IST14853F7 (tigm) IST12370E9 (tigm)
IST10297E12 (tigm)
Private Clones OST22893 (lexicon) OST18617 (lexicon) OST17807 (lexicon) OST13885 (lexicon)
OST2738 (lexicon) OST1668 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142041 (Chr17:35670146..35670239 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCAGTAGACAGCCATGAT Chr17:35670170..35670189 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142041 (Chr17:35670146..35670239 +)
Downstram Exon
ENSMUSE00000142039 (Chr17:35670844..35671590 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCAGTAGACAGCCATGAT Chr17:35670170..35670189 60.1 55 TTTAGGGGGATCAGTGCTTG Chr17:35671067..35671086 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000142041 Chr17:35670146..35670239 GGCCAGTAGACAGCCATGAT Chr17:35670170..35670189 60.1 55

*** Putative Vector Insertion (Chr 17: 35670240 - 35670843) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142039 Chr17:35670844..35671590 TTTAGGGGGATCAGTGCTTG Chr17:35671067..35671086 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGTGATGGAGATGGTCTA Chr17:35670273..35670293 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCGTCAGAATAGGCCAGGA Chr17:35670245..35670265 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024409