Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28723
Trapped Gene
Gal3st1 (ENSMUSG00000049721)
Vector Insertion
Chr 11: 3896911 - 3897055
Public Clones not available
Private Clones OST22569 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715138 (Chr11:3896912..3897054 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGAGCTCTCTTCACCAG Chr11:3896975..3896994 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715138 (Chr11:3896912..3897054 +)
Downstram Exon
ENSMUSE00000516698 (Chr11:3896912..3897054 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGAGCTCTCTTCACCAG Chr11:3896975..3896994 60.13 60 AAGGCCATGTTGGGATACAG Chr11:3897054..3897073 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353045 Chr11:3883639..3883843 No primer for this exon
upstream ENSMUSE00000349028 Chr11:3883716..3883843 No primer for this exon
upstream ENSMUSE00000375711 Chr11:3884944..3885161 AGAGAAGACACAGCGGGATG Chr11:3885093..3885112 60.41 55
upstream ENSMUSE00000682266 Chr11:3889936..3890009 GGAAAAGGGCAGACAGTCAC Chr11:3889982..3890001 59.7 55

*** Putative Vector Insertion (Chr 11: 3896911 - 3897055) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000516698 Chr11:3896912..3897054 AAGGCCATGTTGGGATACAG Chr11:3897054..3897073 59.81 50
downstream ENSMUSE00000715138 Chr11:3896912..3897054 AAGGCCATGTTGGGATACAG Chr11:3897054..3897073 59.81 50
downstream ENSMUSE00000471701 Chr11:3897929..3899311 CCCAGATCGAAGAAGAGCAG Chr11:3898468..3898487 60.09 55
downstream ENSMUSE00000519424 Chr11:3897929..3899329 CCCAGATCGAAGAAGAGCAG Chr11:3898468..3898487 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTAGGGGTTTCCTGAGAT Chr11:3896907..3896927 59.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTAGGGGTTTCCTGAGAT Chr11:3896907..3896927 59.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049721