Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28730
Trapped Gene
Siglec5 (ENSMUSG00000039013)
Vector Insertion
Chr 7: 50611989 - 50613952
Public Clones not available
Private Clones OST22234 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711625 (Chr7:50611935..50611988 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAAAGCTCTTCCCAACGTA Chr7:50611968..50611987 60.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711625 (Chr7:50611935..50611988 +)
Downstram Exon
ENSMUSE00000376892 (Chr7:50613953..50614838 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAAAGCTCTTCCCAACGTA Chr7:50611968..50611987 60.39 50 TTTGGTTTAGAGGGCCACTG Chr7:50614255..50614274 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635168 Chr7:50606765..50606790 No primer for this exon
upstream ENSMUSE00000712027 Chr7:50606778..50606954 TGACATTGAAGCCTGTGACC Chr7:50606817..50606836 59.68 50
upstream ENSMUSE00000384161 Chr7:50606894..50606954 No primer for this exon
upstream ENSMUSE00000714426 Chr7:50606918..50606954 No primer for this exon
upstream ENSMUSE00000281718 Chr7:50607017..50607379 GGACGGTTATTCGCTCTCAG Chr7:50607030..50607049 59.84 55
upstream ENSMUSE00000199270 Chr7:50607538..50607816 CTACCCTGGTGTCTGGCAAT Chr7:50607571..50607590 59.99 55
upstream ENSMUSE00000281704 Chr7:50607992..50608039 AGATGACCATCAGGGTGTCC Chr7:50608004..50608023 59.77 55
upstream ENSMUSE00000281695 Chr7:50610346..50610597 CATCTGCCAAGCTCAGAACA Chr7:50610536..50610555 60.14 50
upstream ENSMUSE00000281688 Chr7:50610697..50610999 CCTGATCCTCAGCATGGAAT Chr7:50610884..50610903 60.03 50
upstream ENSMUSE00000199264 Chr7:50611270..50611369 GAGCTGGTCTTATGGCCTTG Chr7:50611318..50611337 59.84 55
upstream ENSMUSE00000199248 Chr7:50611671..50611806 CAGCTACGAAAGGCAACCAT Chr7:50611709..50611728 60.27 50
upstream ENSMUSE00000711625 Chr7:50611935..50611988 GCAAAGCTCTTCCCAACGTA Chr7:50611968..50611987 60.39 50
upstream ENSMUSE00000712635 Chr7:50611935..50611988 GCAAAGCTCTTCCCAACGTA Chr7:50611968..50611987 60.39 50

*** Putative Vector Insertion (Chr 7: 50611989 - 50613952) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000376892 Chr7:50613953..50614838 TTTGGTTTAGAGGGCCACTG Chr7:50614255..50614274 60.1 50
downstream ENSMUSE00000711723 Chr7:50613953..50614901 TTTGGTTTAGAGGGCCACTG Chr7:50614255..50614274 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTAGCTACCTCCTGCCAAG Chr7:50611985..50612005 60.03 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTAGCTACCTCCTGCCAAG Chr7:50611985..50612005 60.03 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039013