Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28731
Trapped Gene
Mtrf1 (ENSMUSG00000022022)
Vector Insertion
Chr 14: 79819094 - 79823203
Public Clones CMHD-GT_385B1-3 (cmhd) CMHD-GT_541E4-5S (cmhd) CMHD-GT_541E4-3 (cmhd)
Private Clones OST22199 (lexicon) OST18675 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000123018 (Chr14:79818995..79819093 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCGGAGAGAATTCGGACA Chr14:79819011..79819030 59.8 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000123018 (Chr14:79818995..79819093 +)
Downstram Exon
ENSMUSE00000375644 (Chr14:79823204..79823394 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCGGAGAGAATTCGGACA Chr14:79819011..79819030 59.8 50 AAAATTCGGAAATGGCCTCT Chr14:79823291..79823310 59.91 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354994 Chr14:79797579..79797843 CCGTTACGGACACCTAAGGA Chr14:79797698..79797717 59.99 55
upstream ENSMUSE00000388382 Chr14:79799499..79799606 GATCCCAAGGTGGAGAATGA Chr14:79799531..79799550 59.86 50
upstream ENSMUSE00000342422 Chr14:79801229..79801654 CAAGGCCGTGGAATTTTAGA Chr14:79801346..79801365 60.07 45
upstream ENSMUSE00000123026 Chr14:79802632..79802723 No primer for this exon
upstream ENSMUSE00000123020 Chr14:79806384..79806465 GGAGCGTTTAGTGCCTAAGGA Chr14:79806389..79806409 60.74 52.38
upstream ENSMUSE00000123019 Chr14:79806653..79806760 No primer for this exon
upstream ENSMUSE00000123025 Chr14:79811449..79811621 GGATTTCCGGTGACAGTGTT Chr14:79811473..79811492 59.83 50
upstream ENSMUSE00000123024 Chr14:79812794..79812911 ATCCCAAGGATCTGCGAGTA Chr14:79812810..79812829 59.65 50
upstream ENSMUSE00000123021 Chr14:79815685..79815821 CCAACAAGAACGATCACAGC Chr14:79815701..79815720 59.29 50
upstream ENSMUSE00000123018 Chr14:79818995..79819093 AGTCGGAGAGAATTCGGACA Chr14:79819011..79819030 59.8 50

*** Putative Vector Insertion (Chr 14: 79819094 - 79823203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000375644 Chr14:79823204..79823394 AAAATTCGGAAATGGCCTCT Chr14:79823291..79823310 59.91 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGTGGGTTTCAAAAGCTC Chr14:79822084..79822104 60.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGTGGGTTTCAAAAGCTC Chr14:79822084..79822104 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022022