Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28734
Trapped Gene
Defb8 (ENSMUSG00000031471)
Vector Insertion
Chr 8: 19445985 - 19447535
Public Clones not available
Private Clones OST22030 (lexicon) OST19020 (lexicon) OST19017 (lexicon) OST7794 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487809 (Chr8:19447536..19447606 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATTTCTCCTGGTGCTGCT Chr8:19447550..19447569 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487809 (Chr8:19447536..19447606 -)
Downstram Exon
ENSMUSE00000486771 (Chr8:19445769..19445984 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATTTCTCCTGGTGCTGCT Chr8:19447550..19447569 59.87 50 ATATGCCTCCGTTTCGAATG Chr8:19445909..19445928 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487809 Chr8:19447536..19447606 ACATTTCTCCTGGTGCTGCT Chr8:19447550..19447569 59.87 50

*** Putative Vector Insertion (Chr 8: 19445985 - 19447535) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000486771 Chr8:19445769..19445984 ATATGCCTCCGTTTCGAATG Chr8:19445909..19445928 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACATTTCTCCTGGTGCTG Chr8:19447550..19447570 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACATTTCTCCTGGTGCTG Chr8:19447550..19447570 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031471