Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28743
Trapped Gene
Fmo4 (ENSMUSG00000026692)
Vector Insertion
Chr 1: 164724525 - 164725182
Public Clones not available
Private Clones OST21756 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000161900 (Chr1:164725183..164725252 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCCACTAAAACGGAGCA Chr1:164725195..164725214 60.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000161900 (Chr1:164725183..164725252 -)
Downstram Exon
ENSMUSE00000483133 (Chr1:164724014..164724524 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCCACTAAAACGGAGCA Chr1:164725195..164725214 60.39 50 GGGGAAATCTTCTCGGTAGC Chr1:164724105..164724124 60.04 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688161 Chr1:164743707..164743803 AAGTGTGTTTTTGCGGAAGG Chr1:164743740..164743759 60.15 45
upstream ENSMUSE00000433380 Chr1:164742660..164742680 No primer for this exon
upstream ENSMUSE00000688158 Chr1:164742660..164742784 GCATGACGGAGATCTGACAA Chr1:164742760..164742779 59.79 50
upstream ENSMUSE00000433374 Chr1:164739921..164740060 AAGAAGGTGGCAGTGATTGG Chr1:164740027..164740046 60.11 50
upstream ENSMUSE00000721790 Chr1:164739921..164740060 AAGAAGGTGGCAGTGATTGG Chr1:164740027..164740046 60.11 50
upstream ENSMUSE00000161904 Chr1:164738392..164738580 TGACTTCCCATTCCGAGAAG Chr1:164738484..164738503 60.19 50
upstream ENSMUSE00000161910 Chr1:164737652..164737814 GGGCAGTATTTGACGCTGTT Chr1:164737707..164737726 60.14 50
upstream ENSMUSE00000161909 Chr1:164735285..164735427 GATCCTGCACAGCCAAGAGT Chr1:164735386..164735405 60.42 55
upstream ENSMUSE00000161899 Chr1:164733704..164733900 ACGAGTTCTGCCTTCACGTT Chr1:164733780..164733799 59.91 50
upstream ENSMUSE00000161902 Chr1:164728930..164729282 CGATGGGCCACAAGAGTATT Chr1:164728935..164728954 59.96 50
upstream ENSMUSE00000161900 Chr1:164725183..164725252 GAAGCCACTAAAACGGAGCA Chr1:164725195..164725214 60.39 50

*** Putative Vector Insertion (Chr 1: 164724525 - 164725182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000483133 Chr1:164724014..164724524 GGGGAAATCTTCTCGGTAGC Chr1:164724105..164724124 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCATCCCTAATCGCCTTG Chr1:164725120..164725140 59.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000026692