Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28750
Trapped Gene
AC138587.1 (ENSMUSG00000074179)
Vector Insertion
Chr 9: 78145958 - 78146743
Public Clones not available
Private Clones OST21642 (lexicon) OST6334 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635364 (Chr9:78145906..78145957 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAGTCCGGAAGATTTGGA Chr9:78145924..78145943 60.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635364 (Chr9:78145906..78145957 +)
Downstram Exon
ENSMUSE00000635363 (Chr9:78146744..78146876 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAGTCCGGAAGATTTGGA Chr9:78145924..78145943 60.19 50 TGGTGGCGATGTAGTTGAGA Chr9:78146839..78146858 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709524 Chr9:78137730..78137809 TATCGTGCACACTCCTCTGG Chr9:78137744..78137763 59.85 55
upstream ENSMUSE00000711100 Chr9:78137735..78137809 TATCGTGCACACTCCTCTGG Chr9:78137744..78137763 59.85 55
upstream ENSMUSE00000715305 Chr9:78141809..78141922 TTCCACATTGCCTTTCATCA Chr9:78141872..78141891 60.05 40
upstream ENSMUSE00000719837 Chr9:78142591..78142699 CCGTGCTTCACCACTTCAAT Chr9:78142626..78142645 61.1 50
upstream ENSMUSE00000635365 Chr9:78142613..78142699 CCGTGCTTCACCACTTCAAT Chr9:78142626..78142645 61.1 50
upstream ENSMUSE00000635364 Chr9:78145906..78145957 CAGAGTCCGGAAGATTTGGA Chr9:78145924..78145943 60.19 50

*** Putative Vector Insertion (Chr 9: 78145958 - 78146743) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635363 Chr9:78146744..78146876 TGGTGGCGATGTAGTTGAGA Chr9:78146839..78146858 60.26 50
downstream ENSMUSE00000635362 Chr9:78150493..78150634 TTTTTGGTCTGGGGGACATA Chr9:78150574..78150593 60.16 45
downstream ENSMUSE00000635360 Chr9:78152179..78152310 CCTGTTGCCCACAAGGTAGT Chr9:78152223..78152242 60.03 55
downstream ENSMUSE00000531608 Chr9:78153102..78153258 GAGGCTGCTGATTCTGCTCT Chr9:78153131..78153150 59.86 55
downstream ENSMUSE00000709151 Chr9:78153102..78153331 GAGGCTGCTGATTCTGCTCT Chr9:78153131..78153150 59.86 55
downstream ENSMUSE00000715452 Chr9:78153102..78153332 GAGGCTGCTGATTCTGCTCT Chr9:78153131..78153150 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTGAGGTGCCTCGGTAAA Chr9:78145984..78146004 61.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTGAGGTGCCTCGGTAAA Chr9:78145984..78146004 61.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074179