Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28763
Trapped Gene
Mrps36 (ENSMUSG00000061474)
Vector Insertion
Chr 13: 101505909 - 101506229
Public Clones not available
Private Clones OST21209 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679940 (Chr13:101506032..101506228 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCACCAGACAGAAGGGTTAGC Chr13:101506171..101506191 59.34 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679940 (Chr13:101506032..101506228 -)
Downstram Exon
ENSMUSE00000679946 (Chr13:101505910..101506228 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCACCAGACAGAAGGGTTAGC Chr13:101506171..101506191 59.34 52.38 GCAGCTGACCGAGATACACA Chr13:101506009..101506028 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679942 Chr13:101514485..101514612 GCTGCCCACTCCAGATACTT Chr13:101514571..101514590 59.31 55
upstream ENSMUSE00000679954 Chr13:101514485..101514614 GCTGCCCACTCCAGATACTT Chr13:101514571..101514590 59.31 55
upstream ENSMUSE00000679953 Chr13:101511123..101511186 No primer for this exon
upstream ENSMUSE00000461723 Chr13:101508969..101509156 TACGTCCCCCGATTTACTGA Chr13:101509067..101509086 60.32 50
upstream ENSMUSE00000679941 Chr13:101508969..101509150 TACGTCCCCCGATTTACTGA Chr13:101509067..101509086 60.32 50
upstream ENSMUSE00000679940 Chr13:101506032..101506228 TCACCAGACAGAAGGGTTAGC Chr13:101506171..101506191 59.34 52.38
upstream ENSMUSE00000679946 Chr13:101505910..101506228 TCCCAGCGATGAGCTATTAAA Chr13:101505930..101505950 59.82 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCTTGTCACCAGACAGAT Chr13:101506177..101506198 60.47 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACGTGACTGGGAAAACC Chr13:101506162..101506182 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061474