Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28770
Trapped Gene
H2-Ke2 (ENSMUSG00000024309)
Vector Insertion
Chr 17: 34076057 - 34076483
Public Clones CMHD-GT_381G2-3 (cmhd)
Private Clones OST21065 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000140805 (Chr17:34076484..34076608 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGGATCCAACGTGGTCTT Chr17:34076574..34076593 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000140805 (Chr17:34076484..34076608 -)
Downstram Exon
ENSMUSE00000140802 (Chr17:34075872..34076056 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGGATCCAACGTGGTCTT Chr17:34076574..34076593 59.79 50 CTGCAGTTGAGCAAGGGTTT Chr17:34075959..34075978 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000140799 Chr17:34076969..34077274 GAGTTGCGGGTAGAAAGTGC Chr17:34077124..34077143 59.88 55
upstream ENSMUSE00000140806 Chr17:34076693..34076763 AGCTCGAAGCACAGCTAACG Chr17:34076714..34076733 60.87 55
upstream ENSMUSE00000140805 Chr17:34076484..34076608 GATGGATCCAACGTGGTCTT Chr17:34076574..34076593 59.79 50

*** Putative Vector Insertion (Chr 17: 34076057 - 34076483) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000140802 Chr17:34075872..34076056 CTGCAGTTGAGCAAGGGTTT Chr17:34075959..34075978 60.43 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:34076413..34076433 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGTGTTAAACCCGTGCTG Chr17:34076432..34076453 60.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024309