Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28811
Trapped Gene
Letm2 (ENSMUSG00000037363)
Vector Insertion
Chr 8: 26690881 - 26692144
Public Clones not available
Private Clones OST19362 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637650 (Chr8:26692145..26692258 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCCACTTGAAGGAGAACG Chr8:26692231..26692250 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637650 (Chr8:26692145..26692258 -)
Downstram Exon
ENSMUSE00000637649 (Chr8:26690788..26690880 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCCACTTGAAGGAGAACG Chr8:26692231..26692250 59.84 55 GGAGGTGTCGGTATTCCAAG Chr8:26690824..26690843 59.4 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000499277 Chr8:26707592..26707959 CTCCCCTACGGTGTACCTGA Chr8:26707860..26707879 59.98 60
upstream ENSMUSE00000523241 Chr8:26706834..26706917 No primer for this exon
upstream ENSMUSE00000406641 Chr8:26704191..26704638 AAGAAAAGCGGTCGTTGAGA Chr8:26704323..26704342 59.99 45
upstream ENSMUSE00000373214 Chr8:26702924..26703067 CTTCCGCTTGGTTCCATTTA Chr8:26703025..26703044 60.07 45
upstream ENSMUSE00000637654 Chr8:26697768..26697905 GCTGCCAAACTGGAAATAGC Chr8:26697862..26697881 59.85 50
upstream ENSMUSE00000637653 Chr8:26697079..26697279 CCAGCTCCTGATGACACTGA Chr8:26697102..26697121 59.98 55
upstream ENSMUSE00000637652 Chr8:26695821..26695940 AAGGGGTGAAGGCTTTGAGT Chr8:26695908..26695927 60.11 50
upstream ENSMUSE00000637650 Chr8:26692145..26692258 CCTCCACTTGAAGGAGAACG Chr8:26692231..26692250 59.84 55

*** Putative Vector Insertion (Chr 8: 26690881 - 26692144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637649 Chr8:26690788..26690880 GGAGGTGTCGGTATTCCAAG Chr8:26690824..26690843 59.4 55
downstream ENSMUSE00000637648 Chr8:26690192..26690266 GCTGCTGGTGCTATGAGTGA Chr8:26690189..26690208 60.17 55
downstream ENSMUSE00000637647 Chr8:26688967..26689276 CCTTCAAGGGATCCTTAGGC Chr8:26689178..26689197 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTGCATGGATGCAGACAG Chr8:26692121..26692141 59.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGCATGGATGCAGACAG Chr8:26692121..26692141 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037363