Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28814
Trapped Gene
Lysmd2 (ENSMUSG00000032184)
Vector Insertion
Chr 9: 75483525 - 75485018
Public Clones not available
Private Clones OST19310 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217493 (Chr9:75483193..75483524 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGAAGAAGACGCTGAGCA Chr9:75483243..75483262 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217493 (Chr9:75483193..75483524 +)
Downstram Exon
ENSMUSE00000217491 (Chr9:75485019..75485578 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGAAGAAGACGCTGAGCA Chr9:75483243..75483262 60.01 50 ATAGAAAGCCGGGAGCTGAT Chr9:75485232..75485251 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000274963 Chr9:75473548..75473844 GCGCTCAAGTACGGAGTCAC Chr9:75473824..75473843 61.01 60
upstream ENSMUSE00000217493 Chr9:75483193..75483524 TCTGAAGAAGACGCTGAGCA Chr9:75483243..75483262 60.01 50

*** Putative Vector Insertion (Chr 9: 75483525 - 75485018) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217491 Chr9:75485019..75485578 ATAGAAAGCCGGGAGCTGAT Chr9:75485232..75485251 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:75483575..75483595 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCAGCGTCTGGACCAATA Chr9:75483546..75483566 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032184