Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28817
Trapped Gene
Rhox9 (ENSMUSG00000068048)
Vector Insertion
Chr X: 35252477 - 35253456
Public Clones not available
Private Clones OST19125 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000556041 (ChrX:35253457..35253502 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATGGGTGTGGATGAATCT ChrX:35253466..35253485 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000556041 (ChrX:35253457..35253502 -)
Downstram Exon
ENSMUSE00000556039 (ChrX:35252276..35252476 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATGGGTGTGGATGAATCT ChrX:35253466..35253485 59.59 50 CACTCAAGTGCTGCTCCAAA ChrX:35252335..35252354 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517002 ChrX:35254775..35254947 TCCAGAGATTCTCGCTATGGA ChrX:35254852..35254872 59.92 47.62
upstream ENSMUSE00000556042 ChrX:35254129..35254588 GGGAACTATCTGGCTCACCA ChrX:35254219..35254238 60.07 55
upstream ENSMUSE00000556041 ChrX:35253457..35253502 GGATGGGTGTGGATGAATCT ChrX:35253466..35253485 59.59 50

*** Putative Vector Insertion (Chr X: 35252477 - 35253456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556039 ChrX:35252276..35252476 CACTCAAGTGCTGCTCCAAA ChrX:35252335..35252354 60.17 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGTCTAATCGCCTTGCAG ChrX:35253391..35253411 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000068048