Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2882
Trapped Gene
2810026P18Rik (ENSMUSG00000032424)
Vector Insertion
Chr 9: 88416814 - 88417144
Public Clones AE0263 (sanger) AC0239 (sanger) D155B03 (ggtc) E127A12 (ggtc)
Private Clones OST281585 (lexicon) OST278857 (lexicon) OST81746 (lexicon) OST51350 (lexicon)
OST45868 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219686 (Chr9:88417145..88417219 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCCAAAGCATCTGAGAG Chr9:88417192..88417211 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219686 (Chr9:88417145..88417219 -)
Downstram Exon
ENSMUSE00000219689 (Chr9:88416756..88416813 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCCAAAGCATCTGAGAG Chr9:88417192..88417211 60.1 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219688 Chr9:88417322..88417711 ATTCGTACTAAGCGGCCTGA Chr9:88417512..88417531 59.87 50
upstream ENSMUSE00000219686 Chr9:88417145..88417219 GAGCCCAAAGCATCTGAGAG Chr9:88417192..88417211 60.1 55

*** Putative Vector Insertion (Chr 9: 88416814 - 88417144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219689 Chr9:88416756..88416813 No primer for this exon
downstream ENSMUSE00000219687 Chr9:88416488..88416554 ACTGGCATCTCTCGCAAGTT Chr9:88416498..88416517 60.02 50
downstream ENSMUSE00000233255 Chr9:88415893..88416286 TTCATTCGCACGTCTTGTGT Chr9:88416237..88416256 60.31 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATACCGTAATCGCCTTGCAG Chr9:88417079..88417099 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACATACCGCGTGACTGG Chr9:88417084..88417104 62.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAGCCCAAAGCATCTGAGAG Chr9:88417190..88417210 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGCCCAAAGCATCTGAGAG Chr9:88417190..88417210 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032424