Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28820
Trapped Gene
Ssbp3 (ENSMUSG00000061887)
Vector Insertion
Chr 4: 106703697 - 106709540
Public Clones not available
Private Clones OST18984 (lexicon) OST14948 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399590 (Chr4:106703620..106703696 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATGGGAGGATCAATGCAG Chr4:106703629..106703648 60.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399590 (Chr4:106703620..106703696 +)
Downstram Exon
ENSMUSE00000180691 (Chr4:106709541..106709605 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATGGGAGGATCAATGCAG Chr4:106703629..106703648 60.89 50 GAGTTGGGTGGTGGTCTCAT Chr4:106709578..106709597 59.82 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671094 Chr4:106584075..106584517 TTCGGTTGAGCTCCAAGTAGA Chr4:106584082..106584102 60 47.62
upstream ENSMUSE00000180677 Chr4:106585508..106585580 CTGCACGTAGGAGCACAGAA Chr4:106585536..106585555 60.2 55
upstream ENSMUSE00000525680 Chr4:106585810..106585871 No primer for this exon
upstream ENSMUSE00000525679 Chr4:106588250..106588334 ACTGTGCAGCTCCTGAAAGG Chr4:106588267..106588286 60.59 55
upstream ENSMUSE00000631626 Chr4:106622061..106622150 GCAGGCTGTGTGGTTTTCTC Chr4:106622081..106622100 60.84 55
upstream ENSMUSE00000180685 Chr4:106682284..106682373 No primer for this exon
upstream ENSMUSE00000477019 Chr4:106699822..106699902 ACAGCCTCCACCTCACAATC Chr4:106699854..106699873 60.12 55
upstream ENSMUSE00000525678 Chr4:106700798..106700857 CGATCAGAATGGGAAACCAG Chr4:106700838..106700857 60.45 50
upstream ENSMUSE00000358806 Chr4:106703467..106703533 CAATTCCATGGATCCCACAC Chr4:106703505..106703524 60.99 50
upstream ENSMUSE00000399590 Chr4:106703620..106703696 ACATGGGAGGATCAATGCAG Chr4:106703629..106703648 60.89 50

*** Putative Vector Insertion (Chr 4: 106703697 - 106709540) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000180691 Chr4:106709541..106709605 GAGTTGGGTGGTGGTCTCAT Chr4:106709578..106709597 59.82 55
downstream ENSMUSE00000180690 Chr4:106710207..106710255 TGAGTTAGCACTGTTGGGATTG Chr4:106710256..106710277 60.17 45.46
downstream ENSMUSE00000377201 Chr4:106710827..106710862 ACATAGGTTCCGGGTGATGA Chr4:106710864..106710883 60.19 50
downstream ENSMUSE00000710291 Chr4:106711331..106711385 ACTAGGCATGATGGGGGTTC Chr4:106711381..106711400 61.11 55
downstream ENSMUSE00000711216 Chr4:106711331..106711385 ACTAGGCATGATGGGGGTTC Chr4:106711381..106711400 61.11 55
downstream ENSMUSE00000370641 Chr4:106712568..106712638 No primer for this exon
downstream ENSMUSE00000671055 Chr4:106712568..106712638 No primer for this exon
downstream ENSMUSE00000341955 Chr4:106718921..106718999 AGGGATCCATTCATGTGGTG Chr4:106719000..106719019 60.6 50
downstream ENSMUSE00000671054 Chr4:106718921..106718999 AGGGATCCATTCATGTGGTG Chr4:106719000..106719019 60.6 50
downstream ENSMUSE00000382392 Chr4:106719847..106719875 No primer for this exon
downstream ENSMUSE00000671051 Chr4:106719847..106719875 No primer for this exon
downstream ENSMUSE00000396373 Chr4:106719969..106720070 GTCGTTCTGGAAGGAGTGGA Chr4:106720070..106720089 60.24 55
downstream ENSMUSE00000671047 Chr4:106719969..106720070 GTCGTTCTGGAAGGAGTGGA Chr4:106720070..106720089 60.24 55
downstream ENSMUSE00000471947 Chr4:106720629..106722298 AGCTGACACCTGCATCTCCT Chr4:106721411..106721430 60.02 55
downstream ENSMUSE00000631627 Chr4:106720629..106722298 AGCTGACACCTGCATCTCCT Chr4:106721411..106721430 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTAATCGCCTTGCAGCAC Chr4:106703745..106703765 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTATGTCTCCCTGCCATCTG Chr4:106703724..106703744 58.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061887