Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28826
Trapped Gene
Capn9 (ENSMUSG00000031981)
Vector Insertion
Chr 8: 127141392 - 127142381
Public Clones not available
Private Clones OST18724 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678054 (Chr8:127141333..127141391 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTGTTCCAATCTCTCAGTG Chr8:127141333..127141353 59.56 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678054 (Chr8:127141333..127141391 +)
Downstram Exon
ENSMUSE00000678053 (Chr8:127142382..127142625 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTGTTCCAATCTCTCAGTG Chr8:127141333..127141353 59.56 52.38 GGGTCAGAGCAACCTCAGAT Chr8:127142425..127142444 59.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605653 Chr8:127100021..127100257 GGAAGCTGTCATGCCTTACC Chr8:127100035..127100054 59.7 55
upstream ENSMUSE00000215428 Chr8:127112933..127113002 No primer for this exon
upstream ENSMUSE00000579372 Chr8:127115580..127115698 GGATTTGGTTCTGGCTATGC Chr8:127115660..127115679 59.53 50
upstream ENSMUSE00000215437 Chr8:127118529..127118662 GGTCTTCCTCCACTCTGCTG Chr8:127118597..127118616 59.99 60
upstream ENSMUSE00000215431 Chr8:127121399..127121567 ACGGGAGTTATGAGGCACTG Chr8:127121404..127121423 60.13 55
upstream ENSMUSE00000215432 Chr8:127122610..127122693 CTCATTAAGGGCCATGCCTA Chr8:127122652..127122671 60.05 50
upstream ENSMUSE00000215426 Chr8:127124302..127124387 TCAGAGTCCGTAACCCTTGG Chr8:127124333..127124352 60.1 55
upstream ENSMUSE00000215427 Chr8:127127786..127127863 CTTGATGACGGGGAGTTCTG Chr8:127127844..127127863 60.65 55
upstream ENSMUSE00000215433 Chr8:127128090..127128250 TCTGCAACCTCACACCTGAT Chr8:127128134..127128153 59.26 50
upstream ENSMUSE00000579370 Chr8:127129306..127129463 ATTGGCTACGCCATTTACCA Chr8:127129443..127129462 60.34 45
upstream ENSMUSE00000215436 Chr8:127129596..127129804 ACAAGGACGGACACCTGAGT Chr8:127129603..127129622 59.6 55
upstream ENSMUSE00000678057 Chr8:127131855..127131891 No primer for this exon
upstream ENSMUSE00000215430 Chr8:127132993..127133073 GACTCCACAGGAGGAGGAAA Chr8:127133004..127133023 59.23 55
upstream ENSMUSE00000215424 Chr8:127135403..127135460 TGTCAGCTGAGGAGCTTGAAT Chr8:127135413..127135433 60.15 47.62
upstream ENSMUSE00000215423 Chr8:127137317..127137381 GCTGTCCTGCAGAAACATCA Chr8:127137348..127137367 59.99 50
upstream ENSMUSE00000283000 Chr8:127137721..127137789 TGGGACAAGCTGAAACACTG Chr8:127137766..127137785 59.87 50
upstream ENSMUSE00000424359 Chr8:127138448..127138526 TTCGATGTGGACAAGTCTGG Chr8:127138463..127138482 59.68 50
upstream ENSMUSE00000579357 Chr8:127140053..127140169 CCAGCTGGATTTCGATGACT Chr8:127140114..127140133 60.22 50
upstream ENSMUSE00000678054 Chr8:127141333..127141391 GGGTGTTCCAATCTCTCAGTG Chr8:127141333..127141353 59.56 52.38

*** Putative Vector Insertion (Chr 8: 127141392 - 127142381) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678053 Chr8:127142382..127142625 GGGTCAGAGCAACCTCAGAT Chr8:127142425..127142444 59.26 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGCTATAATCGCCTTGCAG Chr8:127141437..127141457 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCAGCAGAGTATGAACACG Chr8:127141420..127141440 60.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031981