Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28838
Trapped Gene
Plac1 (ENSMUSG00000061082)
Vector Insertion
Chr X: 50423172 - 50424066
Public Clones not available
Private Clones OST18381 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000515315 (ChrX:50423179..50424065 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCTACTCGGAGCAAAACC ChrX:50423936..50423955 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000515315 (ChrX:50423179..50424065 -)
Downstram Exon
ENSMUSE00000700770 (ChrX:50423173..50424067 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCTACTCGGAGCAAAACC ChrX:50423936..50423955 60.01 55 GGTTTTGCTCCGAGTAGCTG ChrX:50423914..50423933 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517101 ChrX:50467472..50467582 ATCTTCTCGCTACCCCTTCC ChrX:50467535..50467554 59.67 55
upstream ENSMUSE00000514463 ChrX:50451596..50451667 AAGCCACGTTTCAAAGGAGA ChrX:50451627..50451646 59.85 45
upstream ENSMUSE00000515315 ChrX:50423179..50424065 CAGCTACTCGGAGCAAAACC ChrX:50423936..50423955 60.01 55
upstream ENSMUSE00000700770 ChrX:50423173..50424067 CAGCTACTCGGAGCAAAACC ChrX:50423936..50423955 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCCTGGACGCCTTCTTGT ChrX:50424040..50424060 61.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGCCTTCTTGTCTCCTGTG ChrX:50424032..50424052 60.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061082