Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28843
Trapped Gene
Got1l1 (ENSMUSG00000039720)
Vector Insertion
Chr 8: 28308543 - 28308864
Public Clones not available
Private Clones OST18201 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000508699 (Chr8:28308865..28309030 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGGATAATCACCTCCATCC Chr8:28308893..28308912 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000508699 (Chr8:28308865..28309030 -)
Downstram Exon
ENSMUSE00000472719 (Chr8:28308400..28308542 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGGATAATCACCTCCATCC Chr8:28308893..28308912 59.71 50 GCATCATGTTCTCCACCACA Chr8:28308483..28308502 60.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224971 Chr8:28312844..28313019 TGTTCAGGGATGTACCCACA Chr8:28312923..28312942 59.81 50
upstream ENSMUSE00000224960 Chr8:28311194..28311375 ATGAGTACTTGCCCCTGGTG Chr8:28311269..28311288 59.99 55
upstream ENSMUSE00000224950 Chr8:28310705..28310816 CACATCGTTGGTGAGAGTGG Chr8:28310785..28310804 60.15 55
upstream ENSMUSE00000224942 Chr8:28310310..28310419 ATCTGGAACGCCAGTGATCT Chr8:28310347..28310366 59.69 50
upstream ENSMUSE00000224932 Chr8:28309982..28310074 GCATCCTTGTGATTGGGAAC Chr8:28310039..28310058 60.33 50
upstream ENSMUSE00000388000 Chr8:28309739..28309889 ACTGGTGACCTCGAGGAAGA Chr8:28309822..28309841 59.83 55
upstream ENSMUSE00000508699 Chr8:28308865..28309030 TCGGATAATCACCTCCATCC Chr8:28308893..28308912 59.71 50

*** Putative Vector Insertion (Chr 8: 28308543 - 28308864) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000472719 Chr8:28308400..28308542 GCATCATGTTCTCCACCACA Chr8:28308483..28308502 60.54 50
downstream ENSMUSE00000472652 Chr8:28307932..28308153 AGCGTAAAGCTTTCGTTCCA Chr8:28307940..28307959 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCCTGCTCTGTTTGGAGA Chr8:28308866..28308886 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCTGCTCTGTTTGGAGA Chr8:28308866..28308886 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039720