Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28845
Trapped Gene
9330175E14Rik (ENSMUSG00000074153)
Vector Insertion
Chr 8: 96947705 - 96951643
Public Clones not available
Private Clones OST18104 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680684 (Chr8:96951644..96951802 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGCTATCCCGATCTACCG Chr8:96951758..96951777 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680684 (Chr8:96951644..96951802 -)
Downstram Exon
ENSMUSE00000635062 (Chr8:96946799..96947704 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGCTATCCCGATCTACCG Chr8:96951758..96951777 60.05 50 GCTGGGAGTGGAATTGATGT Chr8:96947280..96947299 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680685 Chr8:96957926..96958057 GAGACCTGACCTGGACAAGC Chr8:96957937..96957956 59.84 60
upstream ENSMUSE00000680684 Chr8:96951644..96951802 TTTGCTATCCCGATCTACCG Chr8:96951758..96951777 60.05 50

*** Putative Vector Insertion (Chr 8: 96947705 - 96951643) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635062 Chr8:96946799..96947704 GCTGGGAGTGGAATTGATGT Chr8:96947280..96947299 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:96951572..96951592 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074153