Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28850
Trapped Gene
Slc16a11 (ENSMUSG00000040938)
Vector Insertion
Chr 11: 70028785 - 70029915
Public Clones not available
Private Clones OST17898 (lexicon) OST17261 (lexicon) OST5756 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459114 (Chr11:70028786..70029915 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTGTGCAGCTCTTTCATC Chr11:70029681..70029700 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459114 (Chr11:70028786..70029915 +)
Downstram Exon
ENSMUSE00000588388 (Chr11:70029639..70029914 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTGTGCAGCTCTTTCATC Chr11:70029681..70029700 59.99 50 GATGAAAGAGCTGCACACCA Chr11:70029703..70029722 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323716 Chr11:70027582..70027766 TACTGGAGAGAGCGGTCCAA Chr11:70027626..70027645 60.93 55
upstream ENSMUSE00000323708 Chr11:70028004..70028177 TCTCCTACGGGCTCTTACGC Chr11:70028092..70028111 61.78 60
upstream ENSMUSE00000588390 Chr11:70028013..70028214 TCTCCTACGGGCTCTTACGC Chr11:70028092..70028111 61.78 60
upstream ENSMUSE00000459102 Chr11:70028019..70028214 TCTCCTACGGGCTCTTACGC Chr11:70028092..70028111 61.78 60
upstream ENSMUSE00000323701 Chr11:70028457..70028600 ATGGTTGGGGGAGTCCTAAC Chr11:70028507..70028526 60.05 55
upstream ENSMUSE00000459118 Chr11:70028457..70028600 ATGGTTGGGGGAGTCCTAAC Chr11:70028507..70028526 60.05 55

*** Putative Vector Insertion (Chr 11: 70028785 - 70029915) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459114 Chr11:70028786..70029915 AGCTCAGCCCTTACCTGACA Chr11:70029570..70029589 60.01 55
downstream ENSMUSE00000588389 Chr11:70028786..70029553 CCAGCCGAAAGTATCAAGGA Chr11:70028949..70028968 60.21 50
downstream ENSMUSE00000588388 Chr11:70029639..70029914 GATGAAAGAGCTGCACACCA Chr11:70029703..70029722 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCCTGTACCCTCATCCTG Chr11:70028751..70028771 59.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTACCCTCTCTCGCGTGACT Chr11:70028823..70028843 59.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040938