Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28854
Trapped Gene
Plac1 (ENSMUSG00000061082)
Vector Insertion
Chr X: 50451668 - 50467471
Public Clones not available
Private Clones OST17860 (lexicon) OST17847 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517101 (ChrX:50467472..50467582 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTTCTCGCTACCCCTTCC ChrX:50467535..50467554 59.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517101 (ChrX:50467472..50467582 -)
Downstram Exon
ENSMUSE00000514463 (ChrX:50451596..50451667 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTTCTCGCTACCCCTTCC ChrX:50467535..50467554 59.67 55 CCTTTGAAACGTGGCTTTGT ChrX:50451608..50451627 60.15 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517101 ChrX:50467472..50467582 ATCTTCTCGCTACCCCTTCC ChrX:50467535..50467554 59.67 55

*** Putative Vector Insertion (Chr X: 50451668 - 50467471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000514463 ChrX:50451596..50451667 CCTTTGAAACGTGGCTTTGT ChrX:50451608..50451627 60.15 45
downstream ENSMUSE00000515315 ChrX:50423179..50424065 GGTTTTGCTCCGAGTAGCTG ChrX:50423914..50423933 60.01 55
downstream ENSMUSE00000700770 ChrX:50423173..50424067 GGTTTTGCTCCGAGTAGCTG ChrX:50423914..50423933 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAGAATTCTCAGCCCAAGA ChrX:50467483..50467504 58.92 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAGAATTCTCAGCCCAAGA ChrX:50467483..50467504 58.92 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061082